Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0029401.1

Orthogroup ID

OG0016298

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 539

Gene Structure 539 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0029401.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 539 bp

cttgagaaaaattcaaggcacattggcagatctgttgggcgttaaattggaggaggagacagaaattggaagagccgctacgttgcataaagagaagatgagaagagaaaaactccttataatcttggacgacgtttgggagagaatagagttgtcaaagatagggattcccagctacaaggagcttcaaatgtgcaagtccaaagtcctactcaccacaaggataaggaatgtctgtcatgtcatgagatgccagagaaagatcaccctcagtatcctatcaaaagaggattcttgggccttgtttgtgagaaatgtaggaatgccttttgaatccaccaaatttaagggtgtagctaagaaggtagctggagaatgtagaggtttaccgattgcattggtagcagttgcaagggcacttggagataaagacctggcggaatgggaaaaagcagctcaacgactagagaaatcacagcttgccaaccctgaccatgaggaagatgcattcaaatgtataagattaagctatgattact

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0006950 GO:0006952 GO:0007154 GO:0007165 GO:0008150 GO:0009987 GO:0016020 GO:0023052 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko04626 map04626

Pfam Domains

Protein Families

LRR_8 NB-ARC TIR

Protein Analysis

179

Amino Acids

20.45

Weight (kDa)

9.19

Isoelectric Point (pI)

36.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016298)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g43661
rosa_chinensis	RchiOBHm_Chr1g0353701 RchiOBHm_Chr3g0468981 RchiOBHm_Chr5g0076011 RchiOBHm_Chr5g0079501
rosa_laevigata	RLG00000002616 RLG00000002880
rosa_multiflora	Rmu_co7975680.1_g000001 Rmu_co8055250.1_g000001 Rmu_sc0001226.1_g000015 Rmu_sc0009227.1_g000012 Rmu_sc0029401.1_g000001
rosa_rugosa	Rorug05G0363200
rosa_wichuraiana	Rw7G022040 Rw7G035180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	120
AciI	CCGC	2 cut(s)	76, 438
AcsI	RAATTY	2 cut(s)	10, 342
AgsI	TTSAA	4 cut(s)	15, 189, 333, 512
AjnI	CCWGG	1 cut(s)	433
AluBI	AGCT	7 cut(s)	175, 185, 357, 369, 456, 479, 529
AluI	AGCT	7 cut(s)	175, 185, 357, 369, 456, 479, 529
Alw26I	GTCTC	1 cut(s)	51
AoxI	GGCC	1 cut(s)	298
ApeKI	GCWGC	1 cut(s)	453
ApoI	RAATTY	2 cut(s)	10, 342
AspS9I	GGNCC	1 cut(s)	298
AsuHPI	GGTGA	2 cut(s)	206, 257
BaeGI	GKGCMC	1 cut(s)	419
BarI	GAAGNNNNNNTAC	2 cut(s)	62, 94
BbvI	GCAGC	1 cut(s)	465
BciT130I	CCWGG	1 cut(s)	435
BciVI	GTATCC	1 cut(s)	285
BcoDI	GTCTC	1 cut(s)	51
BfaI	CTAG	1 cut(s)	465
BfuI	GTATCC	1 cut(s)	285
BglII	AGATCT	1 cut(s)	29
BisI	GCNGC	2 cut(s)	76, 454
BlsI	GCNGC	2 cut(s)	77, 455
Bme1390I	CCNGG	1 cut(s)	435
BmgT120I	GGNCC	1 cut(s)	298
BmrFI	CCNGG	1 cut(s)	435
BmsI	GCATC	2 cut(s)	240, 494
BplI	GAGNNNNNCTC	2 cut(s)	97, 129
BpmI	CTGGAG	1 cut(s)	391
BpuEI	CTTGAG	1 cut(s)	23
BseBI	CCWGG	1 cut(s)	435
BseMII	CTCAG	1 cut(s)	284
BseRI	GAGGAG	2 cut(s)	66, 69
BseSI	GKGCMC	1 cut(s)	419
BseXI	GCAGC	1 cut(s)	465
BseYI	CCCAGC	1 cut(s)	171
BshFI	GGCC	1 cut(s)	300
BsmAI	GTCTC	1 cut(s)	51
BsmI	GAATGC	2 cut(s)	328, 507
BsnI	GGCC	1 cut(s)	300
Bsp1286I	GDGCHC	1 cut(s)	419
Bsp143I	GATC	2 cut(s)	29, 262
BspACI	CCGC	2 cut(s)	76, 438
BspANI	GGCC	1 cut(s)	300
BspCNI	CTCAG	1 cut(s)	283
BspHI	TCATGA	1 cut(s)	244
BspQI	GCTCTTC	1 cut(s)	65
BssMI	GATC	2 cut(s)	29, 262
Bst2UI	CCWGG	1 cut(s)	435
Bst6I	CTCTTC	2 cut(s)	65, 98
BstC8I	GCNNGC	1 cut(s)	481
BstDEI	CTNAG	2 cut(s)	270, 358
BstKTI	GATC	2 cut(s)	32, 265
BstMAI	GTCTC	1 cut(s)	51
BstMBI	GATC	2 cut(s)	29, 262
BstMWI	GCNNNNNNNGC	1 cut(s)	402
BstNI	CCWGG	1 cut(s)	435
BstSCI	CCNGG	1 cut(s)	433
BstSLI	GKGCMC	1 cut(s)	419
BstV1I	GCAGC	1 cut(s)	465
BstX2I	RGATCY	1 cut(s)	29
BstYI	RGATCY	1 cut(s)	29
BsuI	GTATCC	1 cut(s)	285
BsuRI	GGCC	1 cut(s)	300
Cac8I	GCNNGC	1 cut(s)	481
CciI	TCATGA	1 cut(s)	244
Cfr13I	GGNCC	1 cut(s)	298
CviAII	CATG	3 cut(s)	240, 245, 495
CviJI	RGCY	9 cut(s)	75, 175, 185, 300, 357, 369, 456, 479, 529
CviKI_1	RGCY	9 cut(s)	75, 175, 185, 300, 357, 369, 456, 479, 529
DdeI	CTNAG	2 cut(s)	270, 358
DpnI	GATC	2 cut(s)	31, 264
DpnII	GATC	2 cut(s)	29, 262
Eam1104I	CTCTTC	2 cut(s)	65, 98
EarI	CTCTTC	2 cut(s)	65, 98
EciI	GGCGGA	1 cut(s)	453
EcoRII	CCWGG	1 cut(s)	433
EcoT22I	ATGCAT	1 cut(s)	509
FaeI	CATG	3 cut(s)	243, 248, 498
FaiI	YATR	7 cut(s)	88, 120, 241, 246, 496, 519, 532
FatI	CATG	3 cut(s)	239, 244, 494
Fnu4HI	GCNGC	2 cut(s)	76, 454
Fsp4HI	GCNGC	2 cut(s)	76, 454
FspBI	CTAG	1 cut(s)	465
GluI	GCNGC	2 cut(s)	76, 454
GsaI	CCCAGC	1 cut(s)	175
GsuI	CTGGAG	1 cut(s)	391
HaeIII	GGCC	1 cut(s)	300
Hin1II	CATG	3 cut(s)	243, 248, 498
HinfI	GANTC	3 cut(s)	167, 291, 333
HphI	GGTGA	2 cut(s)	206, 257
Hpy166II	GTNNAC	1 cut(s)	387
Hpy188III	TCNNGA	1 cut(s)	245
Hpy8I	GTNNAC	1 cut(s)	387
Hpy99I	CGWCG	1 cut(s)	135
HpyAV	CCTTC	1 cut(s)	356
HpyCH4IV	ACGT	2 cut(s)	81, 133
HpyCH4V	TGCA	5 cut(s)	86, 196, 396, 411, 507
HpyF10VI	GCNNNNNNNGC	1 cut(s)	402
HpyF3I	CTNAG	2 cut(s)	270, 358
HpySE526I	ACGT	2 cut(s)	81, 133
Hsp92II	CATG	3 cut(s)	243, 248, 498
Kzo9I	GATC	2 cut(s)	29, 262
LguI	GCTCTTC	1 cut(s)	65
LmnI	GCTCC	1 cut(s)	182
LpnPI	CCDG	6 cut(s)	185, 267, 355, 420, 447, 502
Lsp1109I	GCAGC	1 cut(s)	465
LweI	GCATC	2 cut(s)	240, 494
MaeI	CTAG	1 cut(s)	465
MaeII	ACGT	2 cut(s)	81, 133
MalI	GATC	2 cut(s)	31, 264
MboI	GATC	2 cut(s)	29, 262
MboII	GAAGA	4 cut(s)	82, 107, 115, 513
MflI	RGATCY	1 cut(s)	29
MhlI	GDGCHC	1 cut(s)	419
MluCI	AATT	4 cut(s)	10, 45, 64, 342
MnlI	CCTC	6 cut(s)	44, 47, 279, 281, 375, 491
Mph1103I	ATGCAT	1 cut(s)	509
MseI	TTAA	3 cut(s)	43, 346, 525
MslI	CAYNNNNRTG	1 cut(s)	512
MspR9I	CCNGG	1 cut(s)	435
Mva1269I	GAATGC	2 cut(s)	328, 507
MvaI	CCWGG	1 cut(s)	435
MwoI	GCNNNNNNNGC	1 cut(s)	402
NdeII	GATC	2 cut(s)	29, 262
NlaIII	CATG	3 cut(s)	243, 248, 498
NsiI	ATGCAT	1 cut(s)	509
PagI	TCATGA	1 cut(s)	244
PciSI	GCTCTTC	1 cut(s)	65
PctI	GAATGC	2 cut(s)	328, 507
PfeI	GAWTC	3 cut(s)	167, 291, 333
PkrI	GCNGC	2 cut(s)	77, 455
PsiI	TTATAA	1 cut(s)	120
Psp6I	CCWGG	1 cut(s)	433
PspFI	CCCAGC	1 cut(s)	171
PspGI	CCWGG	1 cut(s)	433
PspPI	GGNCC	1 cut(s)	298
PsuI	RGATCY	1 cut(s)	29
RseI	CAYNNNNRTG	1 cut(s)	512
SapI	GCTCTTC	1 cut(s)	65
SaqAI	TTAA	3 cut(s)	43, 346, 525
SatI	GCNGC	2 cut(s)	76, 454
Sau3AI	GATC	2 cut(s)	29, 262
Sau96I	GGNCC	1 cut(s)	298
ScrFI	CCNGG	1 cut(s)	435
SduI	GDGCHC	1 cut(s)	419
SfaNI	GCATC	2 cut(s)	240, 494
SmiMI	CAYNNNNRTG	1 cut(s)	512
SmlI	CTYRAG	1 cut(s)	2
SmoI	CTYRAG	1 cut(s)	2
Sse9I	AATT	4 cut(s)	10, 45, 64, 342
SsiI	CCGC	2 cut(s)	76, 438
SspMI	CTAG	1 cut(s)	465
StyD4I	CCNGG	1 cut(s)	433
TaiI	ACGT	2 cut(s)	84, 136
TasI	AATT	4 cut(s)	10, 45, 64, 342
TauI	GCSGC	1 cut(s)	78
TfiI	GAWTC	3 cut(s)	167, 291, 333
Tru1I	TTAA	3 cut(s)	43, 346, 525
Tru9I	TTAA	3 cut(s)	43, 346, 525
TseI	GCWGC	1 cut(s)	453
XapI	RAATTY	2 cut(s)	10, 342
XspI	CTAG	1 cut(s)	465
Zsp2I	ATGCAT	1 cut(s)	509

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.