Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0031226.1

Orthogroup ID

OG0007277

Physical Location & Seq

Genomic Coordinates Forward (+)

41 .. 6427

Gene Structure 6387 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0031226.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1338 bp

atggccgttcgcaacggaaggattctccggattggaagctactcctcagttcaggatatggtagggtatgggactaaagaattagatcttaagggaaaaattgtagtccctggatttattgattcccatgtgcatctgatctttggtggactgcagatgatgcgtgtagaactacatggcataaactcaaaagatgaatttgtgaagaggatcaaagaagctgtgagaaatgcaaaacaaggttcctggattttgggcggtggatggaacaatgatctatggggaggtgagttgccattggcttcttggattgacgatattacaccttataatcctgtctttctatcaagaatggatgggcatatgagcttggctaattcagtggcactcaagttgggtgggattactaaatcatcagtggatccaaatggtggaaccatcatgaaaaccaccagtggagaacctactggactgttgattgattctgcaatggaacatatccttccactcattccagaggtctcagtagaggagcggagggaagctttgcgtaaagccagcaatcatgccttgatgaggggtgtgacgacagttgttgacgttggtagatactttcctgggacttctgtaaaagattcctgggaagatttttcaggtctccatttaagggatcttatcaacaatgttggccaatctatgagccagtggatttatttgggtggggttaaagcatttgctgatgggtcattgggttctcgtagcgcacttttctatgagccgtatgttgatgagcctcataattatggcttacaaggaggagattatgaaagtctccacaacctgaccttagcatcagatagagttgggcttcaggttgctattcatgctataggtgatcgagcaaatgacttgatcctcgacatgtatgagtcagtcatttcaaaaaacggagtgagggatcgaagattcaggattgagcatgcgcagcatctggcacctgggacaccagccagattcggtaaactagggattgttgcttcagtacagatggaggaagtcttttcttcgatcttggataggtgtttccatccagagcacctgttagctgatgccaagtctgtaaacaaaaagcttgggatagacagggctcagagatcttatttattcaagtcactcttgggtagcaatgtagaattggcatttggctccgactggccagttgtagacattaatcctttaggtggtattaagacggcaatgaaaaggatgccccaggcttgggatattgcttgggttccatcagagagcgtttctctgaatgactcactgaaagcgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Amidohydro_3

Protein Analysis

445

Amino Acids

48.91

Weight (kDa)

6.4

Isoelectric Point (pI)

37.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007277)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G55850 AT3G55850 AT3G55850 AT3G55850 AT3G55850 AT3G55850
fragaria_vesca	FvH4_7g03070
malus_domestica	MD07G1040200.v1.1
prunus_persica	Prupe.2G036100_v2.0.a1
pyrus_communis	pycom07g02780
rosa_chinensis	RchiOBHm_Chr1g0324291
rosa_laevigata	RLG00000030207
rosa_multiflora	Rmu_sc0001850.1_g000050 Rmu_sc0031226.1_g000001
rosa_roxburghii	Rroxscaffold_159G00432670 Rroxscaffold_4G00325720
rosa_rugosa	Rorug01G0044600 Rorug01G0044700 Rorug01G0044800
rosa_samantha	Rh1AG060700 Rh1BG051900 Rh1CG063000 Rh1DG067400 Rh4AG012000
rosa_wichuraiana	Rw1G005170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	330
Acc16I	TGCGCA	1 cut(s)	984
AccB1I	GGYRCC	1 cut(s)	994
AccB7I	CCANNNNNTGG	1 cut(s)	431
AccBSI	CCGCTC	1 cut(s)	535
AccI	GTMKAC	1 cut(s)	1224
AccIII	TCCGGA	1 cut(s)	27
AciI	CCGC	2 cut(s)	258, 535
AclWI	GGATC	6 cut(s)	218, 416, 429, 678, 907, 966
AcoI	YGGCCR	3 cut(s)	3, 688, 1214
AcsI	RAATTY	1 cut(s)	197
AcuI	CTGAAG	2 cut(s)	854, 1023
AfaI	GTAC	1 cut(s)	1044
AfiI	CCNNNNNNNGG	6 cut(s)	431, 576, 667, 1241, 1278, 1279
AflII	CTTAAG	1 cut(s)	89
AflIII	ACRYGT	1 cut(s)	921
AgsI	TTSAA	2 cut(s)	942, 1168
AjnI	CCWGG	6 cut(s)	109, 245, 616, 638, 997, 1272
AjuI	GAANNNNNNNTTGG	2 cut(s)	1185, 1217
AluBI	AGCT	6 cut(s)	39, 221, 369, 545, 1106, 1132
AluI	AGCT	6 cut(s)	39, 221, 369, 545, 1106, 1132
Alw21I	GWGCWC	1 cut(s)	1098
Alw26I	GTCTC	3 cut(s)	526, 662, 836
AlwI	GGATC	6 cut(s)	218, 416, 429, 678, 907, 966
AlwNI	CAGNNNCTG	1 cut(s)	991
Aor13HI	TCCGGA	1 cut(s)	27
AoxI	GGCC	3 cut(s)	3, 688, 1214
ApeKI	GCWGC	1 cut(s)	985
ApoI	RAATTY	1 cut(s)	197
AseI	ATTAAT	1 cut(s)	1230
AspLEI	GCGC	2 cut(s)	764, 985
AsuHPI	GGTGA	2 cut(s)	299, 905
BalI	TGGCCA	2 cut(s)	690, 1216
BamHI	GGATCC	1 cut(s)	421
BanI	GGYRCC	1 cut(s)	994
BanII	GRGCYC	1 cut(s)	1150
Bbv12I	GWGCWC	1 cut(s)	1098
BbvI	GCAGC	1 cut(s)	997
BccI	CCATC	7 cut(s)	258, 350, 446, 734, 1042, 1095, 1306
BceAI	ACGGC	2 cut(s)	763, 1269
BciT130I	CCWGG	6 cut(s)	111, 247, 618, 640, 999, 1274
BcoDI	GTCTC	3 cut(s)	526, 662, 836
BfaI	CTAG	1 cut(s)	1025
BfmI	CTRYAG	2 cut(s)	152, 888
BfrI	CTTAAG	1 cut(s)	89
BglII	AGATCT	2 cut(s)	85, 1154
BisI	GCNGC	1 cut(s)	986
BlsI	GCNGC	1 cut(s)	987
Bme1390I	CCNGG	6 cut(s)	111, 247, 618, 640, 999, 1274
BmiI	GGNNCC	6 cut(s)	244, 423, 436, 996, 1207, 1296
BmrFI	CCNGG	6 cut(s)	111, 247, 618, 640, 999, 1274
BmsI	GCATC	6 cut(s)	142, 150, 860, 997, 1099, 1257
BplI	GAGNNNNNCTC	2 cut(s)	1297, 1329
Bpu10I	CCTNAGC	1 cut(s)	847
BpuEI	CTTGAG	1 cut(s)	374
BsaI	GGTCTC	2 cut(s)	526, 662
BsaJI	CCNNGG	5 cut(s)	109, 617, 639, 998, 1272
BsaWI	WCCGGW	1 cut(s)	27
Bsc4I	CCNNNNNNNGG	6 cut(s)	431, 576, 667, 1241, 1278, 1279
Bse1I	ACTGG	5 cut(s)	453, 472, 703, 1217, 1217
Bse3DI	GCAATG	3 cut(s)	495, 1192, 1263
BseAI	TCCGGA	1 cut(s)	27
BseBI	CCWGG	6 cut(s)	111, 247, 618, 640, 999, 1274
BseDI	CCNNGG	5 cut(s)	109, 617, 639, 998, 1272
BseGI	GGATG	4 cut(s)	269, 361, 1087, 1272
BseLI	CCNNNNNNNGG	6 cut(s)	431, 576, 667, 1241, 1278, 1279
BseMI	GCAATG	3 cut(s)	495, 1192, 1263
BseMII	CTCAG	3 cut(s)	60, 537, 1163
BseNI	ACTGG	5 cut(s)	453, 472, 703, 1217, 1217
BseRI	GAGGAG	3 cut(s)	34, 545, 831
BseXI	GCAGC	1 cut(s)	997
BshFI	GGCC	3 cut(s)	5, 690, 1216
BshNI	GGYRCC	1 cut(s)	994
BsiHKAI	GWGCWC	1 cut(s)	1098
BsiSI	CCGG	1 cut(s)	28
BslFI	GGGAC	4 cut(s)	85, 92, 634, 1015
BslI	CCNNNNNNNGG	6 cut(s)	431, 576, 667, 1241, 1278, 1279
BsmAI	GTCTC	3 cut(s)	526, 662, 836
BsmFI	GGGAC	4 cut(s)	85, 92, 634, 1015
BsnI	GGCC	3 cut(s)	5, 690, 1216
Bso31I	GGTCTC	2 cut(s)	526, 662
Bsp1286I	GDGCHC	2 cut(s)	1098, 1150
Bsp13I	TCCGGA	1 cut(s)	27
BspACI	CCGC	2 cut(s)	258, 535
BspANI	GGCC	3 cut(s)	5, 690, 1216
BspCNI	CTCAG	3 cut(s)	59, 536, 1162
BspEI	TCCGGA	1 cut(s)	27
BspHI	TCATGA	1 cut(s)	441
BspLI	GGNNCC	6 cut(s)	244, 423, 436, 996, 1207, 1296
BspMAI	CTGCAG	1 cut(s)	156
BspPI	GGATC	6 cut(s)	218, 416, 429, 678, 907, 966
BspT107I	GGYRCC	1 cut(s)	994
BspTI	CTTAAG	1 cut(s)	89
BspTNI	GGTCTC	2 cut(s)	526, 662
BsrBI	CCGCTC	1 cut(s)	535
BsrDI	GCAATG	3 cut(s)	495, 1192, 1263
BsrI	ACTGG	5 cut(s)	453, 472, 703, 1217, 1217
BssECI	CCNNGG	5 cut(s)	109, 617, 639, 998, 1272
Bst2UI	CCWGG	6 cut(s)	111, 247, 618, 640, 999, 1274
Bst4CI	ACNGT	2 cut(s)	474, 592
Bst6I	CTCTTC	1 cut(s)	200
BstAFI	CTTAAG	1 cut(s)	89
BstAPI	GCANNNNNTGC	1 cut(s)	160
BstC8I	GCNNGC	2 cut(s)	559, 981
BstDEI	CTNAG	4 cut(s)	46, 523, 847, 1149
BstENI	CCTNNNNNAGG	1 cut(s)	574
BstF5I	GGATG	4 cut(s)	269, 361, 1087, 1272
BstHHI	GCGC	2 cut(s)	764, 985
BstMAI	GTCTC	3 cut(s)	526, 662, 836
BstMWI	GCNNNNNNNGC	3 cut(s)	160, 884, 985
BstNI	CCWGG	6 cut(s)	111, 247, 618, 640, 999, 1274
BstNSI	RCATGY	2 cut(s)	925, 983
BstSCI	CCNGG	6 cut(s)	109, 245, 616, 638, 997, 1272
BstSFI	CTRYAG	2 cut(s)	152, 888
BstV1I	GCAGC	1 cut(s)	997
BstX2I	RGATCY	4 cut(s)	85, 421, 670, 1154
BstYI	RGATCY	4 cut(s)	85, 421, 670, 1154
BsuRI	GGCC	3 cut(s)	5, 690, 1216
BtsCI	GGATG	4 cut(s)	269, 361, 1087, 1272
BtsIMutI	CAGTG	5 cut(s)	387, 423, 460, 710, 1325
Cac8I	GCNNGC	2 cut(s)	559, 981
CaiI	CAGNNNCTG	1 cut(s)	991
CciI	TCATGA	1 cut(s)	441
CfoI	GCGC	2 cut(s)	764, 985
Csp6I	GTAC	1 cut(s)	1043
CspCI	CAANNNNNGTGG	2 cut(s)	379, 414
CviAII	CATG	7 cut(s)	128, 176, 442, 566, 884, 922, 980
CviQI	GTAC	1 cut(s)	1043
DdeI	CTNAG	4 cut(s)	46, 523, 847, 1149
EaeI	YGGCCR	3 cut(s)	3, 688, 1214
Eam1104I	CTCTTC	1 cut(s)	200
EarI	CTCTTC	1 cut(s)	200
Eco24I	GRGCYC	1 cut(s)	1150
Eco31I	GGTCTC	2 cut(s)	526, 662
Eco57I	CTGAAG	2 cut(s)	854, 1023
EcoNI	CCTNNNNNAGG	1 cut(s)	574
EcoRII	CCWGG	6 cut(s)	109, 245, 616, 638, 997, 1272
EcoT38I	GRGCYC	1 cut(s)	1150
FaeI	CATG	7 cut(s)	131, 179, 445, 569, 887, 925, 983
FalI	AAGNNNNNCTT	2 cut(s)	1160, 1192
FaqI	GGGAC	4 cut(s)	85, 92, 634, 1015
FatI	CATG	7 cut(s)	127, 175, 441, 565, 883, 921, 979
FauNDI	CATATG	1 cut(s)	363
FblI	GTMKAC	1 cut(s)	1224
Fnu4HI	GCNGC	1 cut(s)	986
FokI	GGATG	4 cut(s)	276, 368, 1074, 1279
FriOI	GRGCYC	1 cut(s)	1150
Fsp4HI	GCNGC	1 cut(s)	986
FspBI	CTAG	1 cut(s)	1025
FspI	TGCGCA	1 cut(s)	984
GlaI	GCGC	2 cut(s)	763, 984
GluI	GCNGC	1 cut(s)	986
HaeIII	GGCC	3 cut(s)	5, 690, 1216
HapII	CCGG	1 cut(s)	28
HhaI	GCGC	2 cut(s)	764, 985
Hin1II	CATG	7 cut(s)	131, 179, 445, 569, 887, 925, 983
Hin6I	GCGC	2 cut(s)	762, 983
HinP1I	GCGC	2 cut(s)	762, 983
HincII	GTYRAC	1 cut(s)	598
HindII	GTYRAC	1 cut(s)	598
HindIII	AAGCTT	2 cut(s)	543, 1130
HinfI	GANTC	8 cut(s)	22, 122, 482, 635, 929, 966, 1014, 1322
HpaII	CCGG	1 cut(s)	28
HphI	GGTGA	2 cut(s)	299, 905
Hpy166II	GTNNAC	5 cut(s)	149, 598, 1022, 1123, 1225
Hpy188I	TCNGA	6 cut(s)	138, 856, 1152, 1210, 1303, 1317
Hpy188III	TCNNGA	7 cut(s)	28, 53, 348, 442, 515, 970, 1091
Hpy8I	GTNNAC	5 cut(s)	149, 598, 1022, 1123, 1225
HpyAV	CCTTC	2 cut(s)	12, 512
HpyCH4III	ACNGT	2 cut(s)	474, 592
HpyCH4IV	ACGT	1 cut(s)	600
HpyCH4V	TGCA	4 cut(s)	133, 154, 233, 488
HpyF10VI	GCNNNNNNNGC	3 cut(s)	160, 884, 985
HpyF3I	CTNAG	4 cut(s)	46, 523, 847, 1149
HpySE526I	ACGT	1 cut(s)	600
Hsp92II	CATG	7 cut(s)	131, 179, 445, 569, 887, 925, 983
HspAI	GCGC	2 cut(s)	762, 983
Kpn2I	TCCGGA	1 cut(s)	27
LmnI	GCTCC	2 cut(s)	532, 1211
Lsp1109I	GCAGC	1 cut(s)	997
LweI	GCATC	6 cut(s)	142, 150, 860, 997, 1099, 1257
MaeI	CTAG	1 cut(s)	1025
MaeII	ACGT	1 cut(s)	600
MaeIII	GTNAC	2 cut(s)	583, 1170
MbiI	CCGCTC	1 cut(s)	535
MboII	GAAGA	4 cut(s)	217, 656, 975, 1056
MflI	RGATCY	4 cut(s)	85, 421, 670, 1154
MhlI	GDGCHC	2 cut(s)	1098, 1150
MlsI	TGGCCA	2 cut(s)	690, 1216
MluCI	AATT	6 cut(s)	80, 99, 197, 376, 799, 1193
MluNI	TGGCCA	2 cut(s)	690, 1216
MlyI	GAGTC	2 cut(s)	938, 1316
MmeI	TCCRAC	1 cut(s)	1233
Mox20I	TGGCCA	2 cut(s)	690, 1216
MroI	TCCGGA	1 cut(s)	27
MscI	TGGCCA	2 cut(s)	690, 1216
MseI	TTAA	5 cut(s)	90, 665, 726, 1230, 1248
MslI	CAYNNNNRTG	1 cut(s)	801
Msp20I	TGGCCA	2 cut(s)	690, 1216
MspCI	CTTAAG	1 cut(s)	89
MspI	CCGG	1 cut(s)	28
MspR9I	CCNGG	6 cut(s)	111, 247, 618, 640, 999, 1274
MvaI	CCWGG	6 cut(s)	111, 247, 618, 640, 999, 1274
MwoI	GCNNNNNNNGC	3 cut(s)	160, 884, 985
NdeI	CATATG	1 cut(s)	363
NlaIII	CATG	7 cut(s)	131, 179, 445, 569, 887, 925, 983
NlaIV	GGNNCC	6 cut(s)	244, 423, 436, 996, 1207, 1296
NmuCI	GTSAC	2 cut(s)	583, 1170
NsbI	TGCGCA	1 cut(s)	984
NspI	RCATGY	2 cut(s)	925, 983
PaeI	GCATGC	1 cut(s)	983
PagI	TCATGA	1 cut(s)	441
PciI	ACATGT	1 cut(s)	921
PfeI	GAWTC	6 cut(s)	22, 122, 482, 635, 966, 1014
PflMI	CCANNNNNTGG	1 cut(s)	431
PfoI	TCCNGGA	1 cut(s)	245
PkrI	GCNGC	1 cut(s)	987
PleI	GAGTC	2 cut(s)	937, 1316
PpsI	GAGTC	2 cut(s)	937, 1316
PscI	ACATGT	1 cut(s)	921
PshBI	ATTAAT	1 cut(s)	1230
PsiI	TTATAA	1 cut(s)	330
Psp6I	CCWGG	6 cut(s)	109, 245, 616, 638, 997, 1272
PspGI	CCWGG	6 cut(s)	109, 245, 616, 638, 997, 1272
PspN4I	GGNNCC	6 cut(s)	244, 423, 436, 996, 1207, 1296
PstI	CTGCAG	1 cut(s)	156
PstNI	CAGNNNCTG	1 cut(s)	991
PsuI	RGATCY	4 cut(s)	85, 421, 670, 1154
RsaI	GTAC	1 cut(s)	1044
RsaNI	GTAC	1 cut(s)	1043
RseI	CAYNNNNRTG	1 cut(s)	801
SaqAI	TTAA	5 cut(s)	90, 665, 726, 1230, 1248
SatI	GCNGC	1 cut(s)	986
SchI	GAGTC	2 cut(s)	938, 1316
ScrFI	CCNGG	6 cut(s)	111, 247, 618, 640, 999, 1274
SduI	GDGCHC	2 cut(s)	1098, 1150
SfaNI	GCATC	6 cut(s)	142, 150, 860, 997, 1099, 1257
SfcI	CTRYAG	2 cut(s)	152, 888
SmiMI	CAYNNNNRTG	1 cut(s)	801
SmlI	CTYRAG	2 cut(s)	89, 389
SmoI	CTYRAG	2 cut(s)	89, 389
SphI	GCATGC	1 cut(s)	983
Sse9I	AATT	6 cut(s)	80, 99, 197, 376, 799, 1193
SsiI	CCGC	2 cut(s)	258, 535
SspMI	CTAG	1 cut(s)	1025
StyD4I	CCNGG	6 cut(s)	109, 245, 616, 638, 997, 1272
TaaI	ACNGT	2 cut(s)	474, 592
TaiI	ACGT	1 cut(s)	603
TaqI	TCGA	4 cut(s)	898, 918, 961, 1067
TasI	AATT	6 cut(s)	80, 99, 197, 376, 799, 1193
TatI	WGTACW	1 cut(s)	1042
TfiI	GAWTC	6 cut(s)	22, 122, 482, 635, 966, 1014
Tru1I	TTAA	5 cut(s)	90, 665, 726, 1230, 1248
Tru9I	TTAA	5 cut(s)	90, 665, 726, 1230, 1248
TscAI	CASTG	5 cut(s)	387, 423, 460, 710, 1332
TseFI	GTSAC	2 cut(s)	583, 1170
TseI	GCWGC	1 cut(s)	985
Tsp45I	GTSAC	2 cut(s)	583, 1170
TspDTI	ATGAA	5 cut(s)	210, 458, 840, 872, 1274
TspGWI	ACGGA	2 cut(s)	30, 963
TspRI	CASTG	5 cut(s)	387, 423, 460, 710, 1332
Van91I	CCANNNNNTGG	1 cut(s)	431
Vha464I	CTTAAG	1 cut(s)	89
VspI	ATTAAT	1 cut(s)	1230
XagI	CCTNNNNNAGG	1 cut(s)	574
XapI	RAATTY	1 cut(s)	197
XceI	RCATGY	2 cut(s)	925, 983
XcmI	CCANNNNNNNNNTGG	1 cut(s)	303
XmiI	GTMKAC	1 cut(s)	1224
XspI	CTAG	1 cut(s)	1025

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.