Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0036102.1

Orthogroup ID

OG0007428

Physical Location & Seq

Genomic Coordinates Forward (+)

868 .. 1675

Gene Structure 808 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0036102.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 270 bp

atggcccaaatcgaaacccagggcatactccaggacatcgaaaccctcatctccgatcagcttcaagtggtttcgtacaaatggctgagtcggaattacttggtgtcgtcaaatgatgcaaagaggttgctccagcagtttgtggaaaaccatggaaatggtttggaagtggtatatactttgtctggtcagttgaagaacaatcctgtgagctaccatgtaaggctcgtttcggggcctcaacttgcaggtagcgtttatcttttgaat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006139 GO:0006259 GO:0006260 GO:0006261 GO:0006281 GO:0006289 GO:0006297 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009987 GO:0033554 GO:0034641 GO:0034645 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044424 GO:0044464 GO:0046483 GO:0050896 GO:0051716 GO:0071704 GO:0090304 GO:1901360 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00230 ko00240 ko01100 ko03030 ko03410 ko03420 ko03430 ko03440 ko05166 map00230 map00240 map01100 map03030 map03410 map03420 map03430 map03440 map05166

Pfam Domains

Protein Families

CDC27

Protein Analysis

90

Amino Acids

10.1

Weight (kDa)

6.02

Isoelectric Point (pI)

43.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007428)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G78650
fragaria_vesca	FvH4_3g18120 FvH4_3g18120
malus_domestica	MD03G1244500.v1.1 MD03G1244600.v1.1 MD11G1266100.v1.1
prunus_persica	Prupe.4G160000_v2.0.a1
pyrus_communis	pycom03g19400 pycom11g23420
rosa_chinensis	RchiOBHm_Chr5g0030181 RchiOBHm_Chr5g0030251 RchiOBHm_Chr5g0030351 RchiOBHm_Chr5g0030441 RchiOBHm_Chr5g0030521
rosa_laevigata	RLG00000033222
rosa_multiflora	Rmu_sc0013101.1_g000006 Rmu_sc0036102.1_g000002
rosa_roxburghii	Rroxscaffold_1G00049780
rosa_rugosa	Rorug05G0118200
rosa_samantha	Rh5AG210400 Rh5BG209600 Rh5CG233000 Rh5DG213800 Rh5DG214100
rosa_wichuraiana	Rw5G019220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	239
AfaI	GTAC	1 cut(s)	77
AgsI	TTSAA	3 cut(s)	65, 196, 268
AjnI	CCWGG	2 cut(s)	18, 30
AluBI	AGCT	2 cut(s)	61, 213
AluI	AGCT	2 cut(s)	61, 213
AoxI	GGCC	2 cut(s)	3, 236
AspS9I	GGNCC	2 cut(s)	4, 236
BciT130I	CCWGG	2 cut(s)	20, 32
BfuAI	ACCTGC	1 cut(s)	239
Bme1390I	CCNGG	2 cut(s)	20, 32
BmgT120I	GGNCC	2 cut(s)	4, 236
BmiI	GGNNCC	1 cut(s)	237
BmrFI	CCNGG	2 cut(s)	20, 32
BmsI	GCATC	1 cut(s)	106
BpmI	CTGGAG	2 cut(s)	14, 116
BsaJI	CCNNGG	3 cut(s)	18, 19, 151
BseBI	CCWGG	2 cut(s)	20, 32
BseDI	CCNNGG	3 cut(s)	18, 19, 151
BseMII	CTCAG	1 cut(s)	77
BshFI	GGCC	2 cut(s)	5, 238
BsnI	GGCC	2 cut(s)	5, 238
Bsp143I	GATC	1 cut(s)	55
Bsp19I	CCATGG	1 cut(s)	151
BspANI	GGCC	2 cut(s)	5, 238
BspCNI	CTCAG	1 cut(s)	78
BspLI	GGNNCC	1 cut(s)	237
BspMI	ACCTGC	1 cut(s)	239
BssECI	CCNNGG	3 cut(s)	18, 19, 151
BssMI	GATC	1 cut(s)	55
BssT1I	CCWWGG	1 cut(s)	151
Bst2UI	CCWGG	2 cut(s)	20, 32
BstDEI	CTNAG	1 cut(s)	86
BstDSI	CCRYGG	1 cut(s)	151
BstKTI	GATC	1 cut(s)	58
BstMBI	GATC	1 cut(s)	55
BstNI	CCWGG	2 cut(s)	20, 32
BstSCI	CCNGG	2 cut(s)	18, 30
BstXI	CCANNNNNNTGG	1 cut(s)	158
BsuRI	GGCC	2 cut(s)	5, 238
BtgI	CCRYGG	1 cut(s)	151
BveI	ACCTGC	1 cut(s)	239
Cfr13I	GGNCC	2 cut(s)	4, 236
Csp6I	GTAC	1 cut(s)	76
CviAII	CATG	2 cut(s)	152, 218
CviJI	RGCY	6 cut(s)	5, 61, 85, 213, 226, 238
CviKI_1	RGCY	6 cut(s)	5, 61, 85, 213, 226, 238
CviQI	GTAC	1 cut(s)	76
DdeI	CTNAG	1 cut(s)	86
DpnI	GATC	1 cut(s)	57
DpnII	GATC	1 cut(s)	55
Eco130I	CCWWGG	1 cut(s)	151
EcoO109I	RGGNCCY	1 cut(s)	236
EcoRII	CCWGG	2 cut(s)	18, 30
EcoT14I	CCWWGG	1 cut(s)	151
ErhI	CCWWGG	1 cut(s)	151
FaeI	CATG	2 cut(s)	155, 221
FaiI	YATR	5 cut(s)	26, 153, 175, 177, 219
FatI	CATG	2 cut(s)	151, 217
GsuI	CTGGAG	2 cut(s)	14, 116
HaeIII	GGCC	2 cut(s)	5, 238
Hin1II	CATG	2 cut(s)	155, 221
HinfI	GANTC	1 cut(s)	88
Hpy188I	TCNGA	2 cut(s)	55, 93
HpyCH4V	TGCA	2 cut(s)	119, 248
HpyF3I	CTNAG	1 cut(s)	86
Hsp92II	CATG	2 cut(s)	155, 221
Kzo9I	GATC	1 cut(s)	55
LmnI	GCTCC	1 cut(s)	135
LpnPI	CCDG	8 cut(s)	5, 17, 32, 44, 146, 171, 219, 234
LweI	GCATC	1 cut(s)	106
MalI	GATC	1 cut(s)	57
MboI	GATC	1 cut(s)	55
MboII	GAAGA	1 cut(s)	208
MluCI	AATT	1 cut(s)	94
MlyI	GAGTC	1 cut(s)	97
MmeI	TCCRAC	1 cut(s)	71
MnlI	CCTC	3 cut(s)	56, 117, 249
MslI	CAYNNNNRTG	1 cut(s)	156
MspR9I	CCNGG	2 cut(s)	20, 32
MvaI	CCWGG	2 cut(s)	20, 32
NcoI	CCATGG	1 cut(s)	151
NdeII	GATC	1 cut(s)	55
NlaIII	CATG	2 cut(s)	155, 221
NlaIV	GGNNCC	1 cut(s)	237
PasI	CCCWGGG	1 cut(s)	19
PfoI	TCCNGGA	1 cut(s)	30
PleI	GAGTC	1 cut(s)	96
PpsI	GAGTC	1 cut(s)	96
Psp6I	CCWGG	2 cut(s)	18, 30
PspGI	CCWGG	2 cut(s)	18, 30
PspN4I	GGNNCC	1 cut(s)	237
PspPI	GGNCC	2 cut(s)	4, 236
RsaI	GTAC	1 cut(s)	77
RsaNI	GTAC	1 cut(s)	76
RseI	CAYNNNNRTG	1 cut(s)	156
Sau3AI	GATC	1 cut(s)	55
Sau96I	GGNCC	2 cut(s)	4, 236
SchI	GAGTC	1 cut(s)	97
ScrFI	CCNGG	2 cut(s)	20, 32
SetI	ASST	4 cut(s)	63, 128, 215, 253
SfaNI	GCATC	1 cut(s)	106
SmiMI	CAYNNNNRTG	1 cut(s)	156
Sse9I	AATT	1 cut(s)	94
StyD4I	CCNGG	2 cut(s)	18, 30
StyI	CCWWGG	1 cut(s)	151
TaqI	TCGA	2 cut(s)	12, 39
TasI	AATT	1 cut(s)	94

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.