Rmu_sc0036570.1_g000001
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0036570.1
Physical Location & Seq
Forward (+)
1 .. 577
577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0036570.1_g000001.1.cds

Sequence Viewer

Length: 357 bp
gactctccacggcagcagataactgcaggaaagcttagggaaataaatgaggaagcaaaaatttttgcagttggaaataaagctcttgctgctctctttgttcatacaccagccggtgagctgcagcgccaactcagatcctggcttggagagcattttgactttctctcagttacgggagatgatgcatcaggaggcgcaaccggtcagttggagcttctttcaactgcaataatggatggttggatggccggacttggtgctgcaattcctccaaatacagatgctctcggtcaacttctatctgagtattcgaagcgggtttatagttctcagttgcagcacctgaagcaatga

Protein Analysis

118

Amino Acids

12.72

Weight (kDa)

5.51

Isoelectric Point (pI)

45.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 319
AclWI GGATC 1 cut(s) 132
AcoI YGGCCR 1 cut(s) 249
AcsI RAATTY 1 cut(s) 60
AgeI ACCGGT 1 cut(s) 203
AgsI TTSAA 1 cut(s) 225
AjnI CCWGG 1 cut(s) 140
AluBI AGCT 4 cut(s) 34, 83, 121, 217
AluI AGCT 4 cut(s) 34, 83, 121, 217
AlwI GGATC 1 cut(s) 132
AlwNI CAGNNNCTG 2 cut(s) 141, 346
AoxI GGCC 1 cut(s) 249
ApeKI GCWGC 6 cut(s) 13, 89, 121, 124, 263, 340
ApoI RAATTY 1 cut(s) 60
AsiGI ACCGGT 1 cut(s) 203
AspLEI GCGC 2 cut(s) 129, 200
AsuHPI GGTGA 1 cut(s) 128
AsuII TTCGAA 1 cut(s) 314
BbvI GCAGC 6 cut(s) 25, 76, 108, 136, 250, 352
BccI CCATC 2 cut(s) 233, 241
BceAI ACGGC 1 cut(s) 26
BciT130I CCWGG 1 cut(s) 142
BfmI CTRYAG 2 cut(s) 24, 122
BfoI RGCGCY 1 cut(s) 130
BisI GCNGC 6 cut(s) 14, 90, 122, 125, 264, 341
BlsI GCNGC 6 cut(s) 15, 91, 123, 126, 265, 342
Bme1390I CCNGG 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 142
BmsI GCATC 3 cut(s) 175, 197, 274
Bpu10I CCTNAGC 1 cut(s) 35
Bpu14I TTCGAA 1 cut(s) 314
BsaJI CCNNGG 1 cut(s) 8
BsaWI WCCGGW 1 cut(s) 203
Bse118I RCCGGY 2 cut(s) 113, 203
BseBI CCWGG 1 cut(s) 142
BseDI CCNNGG 1 cut(s) 8
BseGI GGATG 2 cut(s) 244, 252
BseMII CTCAG 4 cut(s) 148, 183, 297, 347
BseXI GCAGC 6 cut(s) 25, 76, 108, 136, 250, 352
BshFI GGCC 1 cut(s) 251
BshTI ACCGGT 1 cut(s) 203
BsiSI CCGG 3 cut(s) 114, 204, 252
BsnI GGCC 1 cut(s) 251
Bsp119I TTCGAA 1 cut(s) 314
Bsp143I GATC 1 cut(s) 137
BspACI CCGC 1 cut(s) 319
BspANI GGCC 1 cut(s) 251
BspCNI CTCAG 4 cut(s) 147, 182, 298, 346
BspMAI CTGCAG 2 cut(s) 28, 126
BspPI GGATC 1 cut(s) 132
BspT104I TTCGAA 1 cut(s) 314
BsrFI RCCGGY 2 cut(s) 113, 203
BssAI RCCGGY 2 cut(s) 113, 203
BssECI CCNNGG 1 cut(s) 8
BssMI GATC 1 cut(s) 137
Bst2UI CCWGG 1 cut(s) 142
BstBI TTCGAA 1 cut(s) 314
BstDEI CTNAG 5 cut(s) 35, 134, 169, 306, 333
BstDSI CCRYGG 1 cut(s) 8
BstF5I GGATG 2 cut(s) 244, 252
BstH2I RGCGCY 1 cut(s) 130
BstHHI GCGC 2 cut(s) 129, 200
BstKTI GATC 1 cut(s) 140
BstMBI GATC 1 cut(s) 137
BstMWI GCNNNNNNNGC 3 cut(s) 89, 151, 349
BstNI CCWGG 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 140
BstSFI CTRYAG 2 cut(s) 24, 122
BstV1I GCAGC 6 cut(s) 25, 76, 108, 136, 250, 352
BstX2I RGATCY 1 cut(s) 137
BstYI RGATCY 1 cut(s) 137
BsuRI GGCC 1 cut(s) 251
BtgI CCRYGG 1 cut(s) 8
BtsCI GGATG 2 cut(s) 244, 252
CaiI CAGNNNCTG 2 cut(s) 141, 346
CfoI GCGC 2 cut(s) 129, 200
Cfr10I RCCGGY 2 cut(s) 113, 203
CspAI ACCGGT 1 cut(s) 203
CviJI RGCY 7 cut(s) 34, 83, 113, 121, 145, 217, 251
CviKI_1 RGCY 7 cut(s) 34, 83, 113, 121, 145, 217, 251
DdeI CTNAG 5 cut(s) 35, 134, 169, 306, 333
DpnI GATC 1 cut(s) 139
DpnII GATC 1 cut(s) 137
EaeI YGGCCR 1 cut(s) 249
EcoRII CCWGG 1 cut(s) 140
EcoT22I ATGCAT 1 cut(s) 190
FaiI YATR 2 cut(s) 105, 327
FauI CCCGC 1 cut(s) 312
Fnu4HI GCNGC 6 cut(s) 14, 90, 122, 125, 264, 341
FokI GGATG 2 cut(s) 251, 259
Fsp4HI GCNGC 6 cut(s) 14, 90, 122, 125, 264, 341
GlaI GCGC 2 cut(s) 128, 199
GluI GCNGC 6 cut(s) 14, 90, 122, 125, 264, 341
HaeII RGCGCY 1 cut(s) 130
HaeIII GGCC 1 cut(s) 251
HapII CCGG 3 cut(s) 114, 204, 252
HhaI GCGC 2 cut(s) 129, 200
Hin6I GCGC 2 cut(s) 127, 198
HinP1I GCGC 2 cut(s) 127, 198
HincII GTYRAC 1 cut(s) 296
HindII GTYRAC 1 cut(s) 296
HindIII AAGCTT 1 cut(s) 32
HinfI GANTC 1 cut(s) 2
HpaII CCGG 3 cut(s) 114, 204, 252
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 296
Hpy188I TCNGA 2 cut(s) 137, 307
Hpy188III TCNNGA 1 cut(s) 192
Hpy8I GTNNAC 1 cut(s) 296
HpyCH4V TGCA 7 cut(s) 26, 68, 124, 188, 230, 266, 340
HpyF10VI GCNNNNNNNGC 3 cut(s) 89, 151, 349
HpyF3I CTNAG 5 cut(s) 35, 134, 169, 306, 333
HspAI GCGC 2 cut(s) 127, 198
Kzo9I GATC 1 cut(s) 137
LmnI GCTCC 1 cut(s) 214
LpnPI CCDG 8 cut(s) 12, 123, 127, 127, 154, 177, 217, 265
Lsp1109I GCAGC 6 cut(s) 25, 76, 108, 136, 250, 352
LweI GCATC 3 cut(s) 175, 197, 274
MaeIII GTNAC 1 cut(s) 172
MalI GATC 1 cut(s) 139
MboI GATC 1 cut(s) 137
MflI RGATCY 1 cut(s) 137
MluCI AATT 2 cut(s) 60, 267
MmeI TCCRAC 3 cut(s) 52, 192, 224
MnlI CCTC 3 cut(s) 43, 188, 282
Mph1103I ATGCAT 1 cut(s) 190
MspI CCGG 3 cut(s) 114, 204, 252
MspR9I CCNGG 1 cut(s) 142
MvaI CCWGG 1 cut(s) 142
MwoI GCNNNNNNNGC 3 cut(s) 89, 151, 349
NdeII GATC 1 cut(s) 137
NsiI ATGCAT 1 cut(s) 190
NspV TTCGAA 1 cut(s) 314
PinAI ACCGGT 1 cut(s) 203
PkrI GCNGC 6 cut(s) 15, 91, 123, 126, 265, 342
Psp6I CCWGG 1 cut(s) 140
PspGI CCWGG 1 cut(s) 140
PstI CTGCAG 2 cut(s) 28, 126
PstNI CAGNNNCTG 2 cut(s) 141, 346
PsuI RGATCY 1 cut(s) 137
SatI GCNGC 6 cut(s) 14, 90, 122, 125, 264, 341
Sau3AI GATC 1 cut(s) 137
ScrFI CCNGG 1 cut(s) 142
SetI ASST 5 cut(s) 36, 85, 123, 219, 348
SfaNI GCATC 3 cut(s) 175, 197, 274
SfcI CTRYAG 2 cut(s) 24, 122
SfuI TTCGAA 1 cut(s) 314
Sse9I AATT 2 cut(s) 60, 267
SsiI CCGC 1 cut(s) 319
StyD4I CCNGG 1 cut(s) 140
TaqI TCGA 1 cut(s) 314
TaqII GACCGA 1 cut(s) 281
TasI AATT 2 cut(s) 60, 267
TseI GCWGC 6 cut(s) 13, 89, 121, 124, 263, 340
TspDTI ATGAA 1 cut(s) 92
XapI RAATTY 1 cut(s) 60
Zsp2I ATGCAT 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.