Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0038699.1

Orthogroup ID

OG0008380

Physical Location & Seq

Genomic Coordinates Reverse (-)

6860 .. 12006

Gene Structure 5147 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0038699.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 3474 bp

atgaaggctcctacaaatgggtttttggcaacttcagttgaaggagaacagaagaatatcaattcagagttatggcatgcctgtgctgggccattggtttctttgcctccagttggaagtcttgtggtttatttccctcaaggccatagtgagcaagttgcagcatctatgcaaaaggagacggatttcatacctaactaccccaatcttccttcgaaattgatatgcttgcttcacaatgtcacattacatgctgataccgaaacagatgaggtgtatgcgcagatgactctccaaccagtaaacaaatatgacaaggaagcaatactggcgtctgacatgggcctcaagcaaagcaggcaaccttctgagtttttctgcaaaactcttacagctagtgacacaagtactcacggtggattttctgtacctcgtcgtgcagctgagaagatcttcccacctctagattttacaatgcaaccaccagcgcaggagcttgtagcaagagatttgcatgatagtgcatggacattcagacatatttatcgcggccagccaaaaaggcacctgctgactactggttggagtgttttcgttagcacaaaaagactctttgctggagatgctgttctttttataagagatgaaaaatctcagcttctcttgggtataaggcgtgctaataggcagcaaccagctctctcttcatcagtcatttccagtgatagcatgcatattggaattcttgcagctgcagctcatgctactgcaagtaacagtccatttaccatattttacaacccgagggccagcccttctgagtttgtggtacctttagccaagtacaataaagcgatgtatacccaagtttcacttggcatgcgattcagaatgatgtttgagactgaagagtcaggagttcgcagatacatgggtacaatcactggcattagcgagttggatcctgttcgttggaaaagttctcaatggcgcaatcttcaggttggatgggatgaatcaacggctggtgatcggcctagccgagtttcaatttgggaaattgagcctgttgtaactcctttctacatctgcccacctccattctttagaccaaagtttcccaaacaaccagggatgccagatgatgaatctgacatggagaatgctttcaagagagccatgccatggcttggagatgagtttggcatgaaaaattccccaagctcgattttccctggtttgagtttagtgcagtggatgaatatgcaacaaaataatcagttttcagcccctcagtctggatttttcccatccatggttcctccaactaccctgcataacggtactgatgatccatccaagttgctgaattttcaagctcctggtctaactgcaccaggccagttaaataaagcagctccaccaaatcaagttagtcaagtgcaacagccaactgtgacatggccccaacagcagcagctgcagcaactaatgcagaatcctatgaaccaacagcagcaaaatcactcgcaacagcaacagctacaacaattattgcatactcctttgaaccaacagcagcaaaatcatccccaacagcagcagctgcagcaattaatgcagactcctgcgaaccaacagctgcaaaattactctcagcagcaacagcagcaacgggagcaacaaaaccatcaagaacctcaaggccttcaacagctgcagcaacttcatcagctacatcagcagcaaccacaacggcaacagtcacagcaacaacaacagttaggtcaaccaactcttgtaagtaatggtcctgttactccaaaccaaatcccaagccaaaattcacagcaaccaatgatgttcactcagcttcagcaacagcattcactaacaagcagtacccaatcccagcaagcagtccacactcctaataagaattcattccagtcggcagctggcacacaagactcacaaattcagcaacaattggaactgcaaccaagcctgttgcaacggcagcagcaggcacagttgcaacagtccccattgcagttgttgcaacagccgcagaaagcacagcagcagccacaagtacaatcatcgtcacaacaggctttgtctgagcaacaacttcacttacagttgcttcagaaattgcagcagcaacagcaacagcagcagcaaccacaattattctctccatcaagcccacttttgcagccgcaaatgctacagcagcagctggcccatcaacaaaaccagcaattacaacagttgcagttgcctctgtctcagcatcatcagcaacagctaagcggtaacagcttctcagcagacaaacttctcagcagcaacaacttctcggcttcaccaatgatgcaggcccaacatgtttcatctatccaacaacagaaccagcacaagccagttacagcaatcagaagccattccaatcttacagagggggacggtccatcatgttcaacctccccttctacaaataattgccaggtgtcctcatcaaacctactgaacaggaatcagcaaggaacagccatgttgataggggatccagtggcggagccttctagtaacttggttcatgattttcagagcaagtctgatattcgaatcaaacatgagttgcccatttcaaaaggactggaccaaattaaatataaaggtaccatcactgatcagttggaagcttcctcttctggaacttcatactgtctggatgctagcacaatacagcagaactacgcgctcccatccttctgtttagatggtgatgtccaatcacatcctcggaacaatcttccgttttcagctaatgttgatggattggcacctgacactttgatgtcaagaggatatgactctcagaaagatcttcagaacttactgtctaattatggtgggacaccaagagatattgagacagagctatctactgctgcaatcagctctcaatcatttggggcgccaaacatgccattcaagcctgggtgctctagtgatgttgctctaaatgatgctggagttctaaataatggtttgtggggatcacaggcccaacgtttgagaacgtatacaaaggttcaaaagcgtggatcagtgggaagatgtattgatgttacccggtataaaggctatgatgagctcaggcatgatctagcccgcatgtttgggattgaagggcaactagaagatccacaaagaactgactggaagcttgtttatgtggatcacgaaaatgacatacttcttgttggtgatgatccgtgggaggagtttgtgagctgtgtccagagtataaagatactgtcatctgttgaagtacaacaaatgagcttggatggagatctgggaaatgttcctgttcccaaccaagcttgcagtggaactgacagtggaaatgcatggagggcaccatatgaagataactcggcagcctcattcaatcggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0007275 GO:0008150 GO:0009653 GO:0009719 GO:0009723 GO:0009725 GO:0009733 GO:0009791 GO:0009889 GO:0010015 GO:0010033 GO:0010101 GO:0010102 GO:0010311 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0022622 GO:0031323 GO:0031326 GO:0032501 GO:0032502 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044424 GO:0044464 GO:0046983 GO:0048364 GO:0048366 GO:0048367 GO:0048527 GO:0048528 GO:0048646 GO:0048731 GO:0048827 GO:0048856 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0090696 GO:0090697 GO:0090698 GO:0097159 GO:0099402 GO:0140110 GO:1901363 GO:1903506 GO:1905392 GO:1905393 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

ko04075 map04075

Pfam Domains

Protein Families

AUX_IAA Auxin_resp B3

Protein Analysis

1157

Amino Acids

129.36

Weight (kDa)

6.18

Isoelectric Point (pI)

69.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008380)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G19220 AT5G20730 AT5G20730 AT5G20730
fragaria_vesca	FvH4_1g09150 FvH4_1g09150 FvH4_1g09150
malus_domestica	MD02G1096700.v1.1 MD15G1221400.v1.1
prunus_persica	Prupe.7G194200_v2.0.a1 Prupe.7G194200_v2.0.a1
pyrus_communis	pycom02g07670
rosa_chinensis	RchiOBHm_Chr2g0095551
rosa_laevigata	RLG00000016578
rosa_multiflora	Rmu_sc0005382.1_g000007 Rmu_sc0038699.1_g000002
rosa_roxburghii	Rroxscaffold_2G00146200
rosa_rugosa	Rorug02G0052300
rosa_samantha	Rh2AG100100 Rh2BG101600 Rh2CG103700 Rh2DG101000
rosa_wichuraiana	Rw2G007600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	638
AarI	CACCTGC	1 cut(s)	576
AasI	GACNNNNNNGTC	1 cut(s)	910
Acc16I	TGCGCA	1 cut(s)	282
Acc36I	ACCTGC	1 cut(s)	576
Acc65I	GGTACC	2 cut(s)	829, 2687
AccB1I	GGYRCC	6 cut(s)	564, 829, 2687, 2851, 2986, 3433
AccB7I	CCANNNNNTGG	2 cut(s)	1185, 1190
AccI	GTMKAC	2 cut(s)	860, 3095
AccII	CGCG	2 cut(s)	549, 2768
AciI	CCGC	6 cut(s)	549, 2069, 2225, 2319, 2582, 3184
AclI	AACGTT	1 cut(s)	3082
AcoI	YGGCCR	1 cut(s)	550
AcsI	RAATTY	6 cut(s)	741, 1213, 1369, 1843, 1939, 1977
AcuI	CTGAAG	6 cut(s)	18, 927, 983, 1859, 2135, 2882
AcyI	GRCGYC	2 cut(s)	332, 2987
AfiI	CCNNNNNNNGG	7 cut(s)	17, 87, 113, 1185, 1190, 1298, 1315
AflIII	ACRYGT	1 cut(s)	2392
AjnI	CCWGG	6 cut(s)	1129, 1234, 1381, 1396, 2511, 3007
AjuI	GAANNNNNNNTTGG	2 cut(s)	1828, 1860
AloI	GAACNNNNNNTCC	2 cut(s)	612, 644
Alw21I	GWGCWC	2 cut(s)	3017, 3168
Alw26I	GTCTC	4 cut(s)	173, 896, 2298, 2936
AlwNI	CAGNNNCTG	3 cut(s)	1480, 1606, 2245
Ama87I	CYCGRG	1 cut(s)	802
ApoI	RAATTY	6 cut(s)	741, 1213, 1369, 1843, 1939, 1977
AseI	ATTAAT	1 cut(s)	1616
Asp700I	GAANNNNTTC	4 cut(s)	452, 1166, 1943, 2449
Asp718I	GGTACC	2 cut(s)	829, 2687
AspLEI	GCGC	5 cut(s)	283, 490, 993, 2770, 2989
AsuC2I	CCSGG	1 cut(s)	3145
AsuHPI	GGTGA	4 cut(s)	1040, 2364, 2804, 3290
AsuII	TTCGAA	2 cut(s)	215, 2632
AsuNHI	GCTAGC	1 cut(s)	2744
AvaI	CYCGRG	1 cut(s)	802
AvaII	GGWCC	3 cut(s)	1811, 2474, 2668
BaeGI	GKGCMC	1 cut(s)	3436
BaeI	ACNNNNGTAYC	2 cut(s)	919, 952
BamHI	GGATCC	2 cut(s)	961, 2572
BanI	GGYRCC	6 cut(s)	564, 829, 2687, 2851, 2986, 3433
BanII	GRGCYC	1 cut(s)	3168
Bbv12I	GWGCWC	2 cut(s)	3017, 3168
BceAI	ACGGC	3 cut(s)	1038, 1772, 2033
BciT130I	CCWGG	6 cut(s)	1131, 1236, 1383, 1398, 2513, 3009
BclI	TGATCA	1 cut(s)	2698
BcnI	CCSGG	1 cut(s)	3145
BcoDI	GTCTC	4 cut(s)	173, 896, 2298, 2936
BfaI	CTAG	8 cut(s)	396, 464, 1038, 2592, 2745, 3018, 3179, 3209
BfmI	CTRYAG	5 cut(s)	753, 1481, 1607, 1718, 2234
BfoI	RGCGCY	1 cut(s)	2990
BfuAI	ACCTGC	1 cut(s)	576
BglI	GCCNNNNNGGC	1 cut(s)	562
BglII	AGATCT	3 cut(s)	450, 2893, 3367
BlpI	GCTNAGC	1 cut(s)	2315
BmcAI	AGTACT	1 cut(s)	409
Bme1390I	CCNGG	7 cut(s)	1131, 1236, 1383, 1398, 2513, 3009, 3145
Bme18I	GGWCC	3 cut(s)	1811, 2474, 2668
BmeT110I	CYCGRG	1 cut(s)	802
BmrFI	CCNGG	7 cut(s)	1131, 1236, 1383, 1398, 2513, 3009, 3145
BmsI	GCATC	7 cut(s)	173, 613, 1125, 2308, 2370, 2731, 3028
BmtI	GCTAGC	1 cut(s)	2748
BpmI	CTGGAG	3 cut(s)	93, 639, 3063
Bpu10I	CCTNAGC	1 cut(s)	3167
Bpu1102I	GCTNAGC	1 cut(s)	2315
Bpu14I	TTCGAA	2 cut(s)	215, 2632
BpuEI	CTTGAG	3 cut(s)	123, 332, 1686
BpuMI	CCSGG	1 cut(s)	3145
BsaBI	GATNNNNATC	1 cut(s)	3366
BsaHI	GRCGYC	2 cut(s)	332, 2987
BsaJI	CCNNGG	8 cut(s)	803, 1130, 1184, 1234, 1314, 2810, 3008, 3287
BsaXI	ACNNNNNCTCC	2 cut(s)	612, 642
Bsc4I	CCNNNNNNNGG	7 cut(s)	17, 87, 113, 1185, 1190, 1298, 1315
Bse3DI	GCAATG	1 cut(s)	2048
Bse8I	GATNNNNATC	1 cut(s)	3366
BseBI	CCWGG	6 cut(s)	1131, 1236, 1383, 1398, 2513, 3009
BseDI	CCNNGG	8 cut(s)	803, 1130, 1184, 1234, 1314, 2810, 3008, 3287
BseJI	GATNNNNATC	1 cut(s)	3366
BseLI	CCNNNNNNNGG	7 cut(s)	17, 87, 113, 1185, 1190, 1298, 1315
BseMI	GCAATG	1 cut(s)	2048
BseRI	GAGGAG	1 cut(s)	3308
BseSI	GKGCMC	1 cut(s)	3436
BseYI	CCCAGC	2 cut(s)	86, 1911
BsgI	GTGCAG	3 cut(s)	459, 1271, 1377
Bsh1236I	CGCG	2 cut(s)	549, 2768
BshNI	GGYRCC	6 cut(s)	564, 829, 2687, 2851, 2986, 3433
BsiHKAI	GWGCWC	2 cut(s)	3017, 3168
BsiHKCI	CYCGRG	1 cut(s)	802
BsiSI	CCGG	1 cut(s)	3145
BslFI	GGGAC	3 cut(s)	2029, 2483, 2938
BslI	CCNNNNNNNGG	7 cut(s)	17, 87, 113, 1185, 1190, 1298, 1315
BsmAI	GTCTC	4 cut(s)	173, 896, 2298, 2936
BsmBI	CGTCTC	1 cut(s)	173
BsmFI	GGGAC	3 cut(s)	2029, 2483, 2938
BsmI	GAATGC	2 cut(s)	1168, 1885
BsoBI	CYCGRG	1 cut(s)	802
Bsp119I	TTCGAA	2 cut(s)	215, 2632
Bsp1286I	GDGCHC	3 cut(s)	3017, 3168, 3436
Bsp1720I	GCTNAGC	1 cut(s)	2315
Bsp19I	CCATGG	2 cut(s)	1184, 1314
BspACI	CCGC	6 cut(s)	549, 2069, 2225, 2319, 2582, 3184
BspFNI	CGCG	2 cut(s)	549, 2768
BspHI	TCATGA	1 cut(s)	2605
BspMAI	CTGCAG	4 cut(s)	757, 1485, 1611, 1722
BspMI	ACCTGC	1 cut(s)	576
BspOI	GCTAGC	1 cut(s)	2748
BspT104I	TTCGAA	2 cut(s)	215, 2632
BspT107I	GGYRCC	6 cut(s)	564, 829, 2687, 2851, 2986, 3433
BsrDI	GCAATG	1 cut(s)	2048
BssECI	CCNNGG	8 cut(s)	803, 1130, 1184, 1234, 1314, 2810, 3008, 3287
BssNAI	GTATAC	2 cut(s)	861, 3096
BssNI	GRCGYC	2 cut(s)	332, 2987
BssT1I	CCWWGG	2 cut(s)	1184, 1314
Bst1107I	GTATAC	2 cut(s)	861, 3096
Bst2UI	CCWGG	6 cut(s)	1131, 1236, 1383, 1398, 2513, 3009
Bst6I	CTCTTC	3 cut(s)	709, 903, 2722
BstACI	GRCGYC	2 cut(s)	332, 2987
BstAPI	GCANNNNNTGC	6 cut(s)	761, 1480, 1492, 1606, 1618, 2059
BstBI	TTCGAA	2 cut(s)	215, 2632
BstDSI	CCRYGG	3 cut(s)	1184, 1314, 3287
BstFNI	CGCG	2 cut(s)	549, 2768
BstH2I	RGCGCY	1 cut(s)	2990
BstHHI	GCGC	5 cut(s)	283, 490, 993, 2770, 2989
BstMAI	GTCTC	4 cut(s)	173, 896, 2298, 2936
BstNI	CCWGG	6 cut(s)	1131, 1236, 1383, 1398, 2513, 3009
BstNSI	RCATGY	7 cut(s)	80, 254, 733, 883, 2396, 2998, 3190
BstSCI	CCNGG	7 cut(s)	1129, 1234, 1381, 1396, 2511, 3007, 3143
BstSFI	CTRYAG	5 cut(s)	753, 1481, 1607, 1718, 2234
BstSLI	GKGCMC	1 cut(s)	3436
BstUI	CGCG	2 cut(s)	549, 2768
BstX2I	RGATCY	6 cut(s)	450, 961, 2572, 2893, 3214, 3367
BstYI	RGATCY	6 cut(s)	450, 961, 2572, 2893, 3214, 3367
BstZ17I	GTATAC	2 cut(s)	861, 3096
BtgI	CCRYGG	3 cut(s)	1184, 1314, 3287
BtgZI	GCGATG	1 cut(s)	869
BtsI	GCAGTG	2 cut(s)	1259, 3409
BtsIMutI	CAGTG	8 cut(s)	727, 942, 1259, 2583, 2694, 3126, 3409, 3421
BveI	ACCTGC	1 cut(s)	576
CaiI	CAGNNNCTG	3 cut(s)	1480, 1606, 2245
CciI	TCATGA	1 cut(s)	2605
CfoI	GCGC	5 cut(s)	283, 490, 993, 2770, 2989
CseI	GACGC	1 cut(s)	321
DinI	GGCGCC	1 cut(s)	2988
DrdI	GACNNNNNNGTC	1 cut(s)	910
DseDI	GACNNNNNNGTC	1 cut(s)	910
EaeI	YGGCCR	1 cut(s)	550
Eam1104I	CTCTTC	3 cut(s)	709, 903, 2722
EarI	CTCTTC	3 cut(s)	709, 903, 2722
EciI	GGCGGA	1 cut(s)	2597
Ecl136II	GAGCTC	1 cut(s)	3166
Eco130I	CCWWGG	2 cut(s)	1184, 1314
Eco147I	AGGCCT	1 cut(s)	1707
Eco24I	GRGCYC	1 cut(s)	3168
Eco47I	GGWCC	3 cut(s)	1811, 2474, 2668
Eco53kI	GAGCTC	1 cut(s)	3166
Eco57I	CTGAAG	6 cut(s)	18, 927, 983, 1859, 2135, 2882
Eco88I	CYCGRG	1 cut(s)	802
EcoICRI	GAGCTC	1 cut(s)	3166
EcoRI	GAATTC	2 cut(s)	741, 1939
EcoRII	CCWGG	6 cut(s)	1129, 1234, 1381, 1396, 2511, 3007
EcoT14I	CCWWGG	2 cut(s)	1184, 1314
EcoT22I	ATGCAT	2 cut(s)	735, 3427
EcoT38I	GRGCYC	1 cut(s)	3168
EgeI	GGCGCC	1 cut(s)	2988
EheI	GGCGCC	1 cut(s)	2988
ErhI	CCWWGG	2 cut(s)	1184, 1314
Esp3I	CGTCTC	1 cut(s)	173
FalI	AAGNNNNNCTT	2 cut(s)	858, 890
FaqI	GGGAC	3 cut(s)	2029, 2483, 2938
FauI	CCCGC	1 cut(s)	3191
FauNDI	CATATG	1 cut(s)	3439
FbaI	TGATCA	1 cut(s)	2698
FblI	GTMKAC	2 cut(s)	860, 3095
FriOI	GRGCYC	1 cut(s)	3168
FspBI	CTAG	8 cut(s)	396, 464, 1038, 2592, 2745, 3018, 3179, 3209
FspI	TGCGCA	1 cut(s)	282
GlaI	GCGC	5 cut(s)	282, 489, 992, 2769, 2988
GsaI	CCCAGC	2 cut(s)	90, 1915
GsuI	CTGGAG	3 cut(s)	93, 639, 3063
HaeII	RGCGCY	1 cut(s)	2990
HapII	CCGG	1 cut(s)	3145
HgaI	GACGC	1 cut(s)	321
HhaI	GCGC	5 cut(s)	283, 490, 993, 2770, 2989
Hin1I	GRCGYC	2 cut(s)	332, 2987
Hin6I	GCGC	5 cut(s)	281, 488, 991, 2768, 2987
HinP1I	GCGC	5 cut(s)	281, 488, 991, 2768, 2987
HincII	GTYRAC	1 cut(s)	1790
HindII	GTYRAC	1 cut(s)	1790
HindIII	AAGCTT	3 cut(s)	2709, 3236, 3396
HpaII	CCGG	1 cut(s)	3145
HphI	GGTGA	4 cut(s)	1040, 2364, 2804, 3290
Hpy166II	GTNNAC	6 cut(s)	304, 861, 1790, 1866, 1924, 3096
Hpy8I	GTNNAC	6 cut(s)	304, 861, 1790, 1866, 1924, 3096
Hpy99I	CGWCG	1 cut(s)	438
HpyAV	CCTTC	9 cut(s)	35, 222, 375, 825, 1718, 2505, 2598, 2788, 3194
HpyCH4IV	ACGT	2 cut(s)	3082, 3092
HpySE526I	ACGT	2 cut(s)	3082, 3092
Hsp92I	GRCGYC	2 cut(s)	332, 2987
HspAI	GCGC	5 cut(s)	281, 488, 991, 2768, 2987
KasI	GGCGCC	1 cut(s)	2986
KpnI	GGTACC	2 cut(s)	833, 2691
Ksp22I	TGATCA	1 cut(s)	2698
LmnI	GCTCC	7 cut(s)	13, 493, 1384, 1423, 1678, 2584, 2775
LweI	GCATC	7 cut(s)	173, 613, 1125, 2308, 2370, 2731, 3028
MaeI	CTAG	8 cut(s)	396, 464, 1038, 2592, 2745, 3018, 3179, 3209
MaeII	ACGT	2 cut(s)	3082, 3092
MfeI	CAATTG	1 cut(s)	1988
MflI	RGATCY	6 cut(s)	450, 961, 2572, 2893, 3214, 3367
MhlI	GDGCHC	3 cut(s)	3017, 3168, 3436
Mly113I	GGCGCC	1 cut(s)	2987
MlyI	GAGTC	6 cut(s)	283, 603, 920, 1618, 1964, 2876
MmeI	TCCRAC	9 cut(s)	94, 319, 563, 939, 953, 985, 1349, 2431, 2685
Mph1103I	ATGCAT	2 cut(s)	735, 3427
MroXI	GAANNNNTTC	4 cut(s)	452, 1166, 1943, 2449
MseI	TTAA	3 cut(s)	1406, 1616, 2676
MslI	CAYNNNNRTG	4 cut(s)	81, 519, 2864, 3258
MspA1I	CMGCKG	8 cut(s)	443, 752, 1480, 1606, 1642, 1717, 1958, 2245
MspI	CCGG	1 cut(s)	3145
MspR9I	CCNGG	7 cut(s)	1131, 1236, 1383, 1398, 2513, 3009, 3145
MunI	CAATTG	1 cut(s)	1988
Mva1269I	GAATGC	2 cut(s)	1168, 1885
MvaI	CCWGG	6 cut(s)	1131, 1236, 1383, 1398, 2513, 3009
MvnI	CGCG	2 cut(s)	549, 2768
NarI	GGCGCC	1 cut(s)	2987
NciI	CCSGG	1 cut(s)	3145
NcoI	CCATGG	2 cut(s)	1184, 1314
NdeI	CATATG	1 cut(s)	3439
NheI	GCTAGC	1 cut(s)	2744
NmeAIII	GCCGAG	3 cut(s)	1067, 2345, 3431
NmuCI	GTSAC	5 cut(s)	241, 398, 1456, 1764, 2106
NsbI	TGCGCA	1 cut(s)	282
NsiI	ATGCAT	2 cut(s)	735, 3427
NspI	RCATGY	7 cut(s)	80, 254, 733, 883, 2396, 2998, 3190
NspV	TTCGAA	2 cut(s)	215, 2632
PaeI	GCATGC	3 cut(s)	80, 733, 883
PagI	TCATGA	1 cut(s)	2605
PaqCI	CACCTGC	1 cut(s)	576
PceI	AGGCCT	1 cut(s)	1707
PciI	ACATGT	1 cut(s)	2392
PcsI	WCGNNNNNNNCGW	1 cut(s)	1039
PctI	GAATGC	2 cut(s)	1168, 1885
PdmI	GAANNNNTTC	4 cut(s)	452, 1166, 1943, 2449
PfeI	GAWTC	6 cut(s)	885, 1016, 1148, 1498, 2542, 2634
PflMI	CCANNNNNTGG	2 cut(s)	1185, 1190
PleI	GAGTC	6 cut(s)	283, 603, 919, 1618, 1964, 2876
PluTI	GGCGCC	1 cut(s)	2990
PpsI	GAGTC	6 cut(s)	283, 603, 919, 1618, 1964, 2876
PscI	ACATGT	1 cut(s)	2392
PshBI	ATTAAT	1 cut(s)	1616
PsiI	TTATAA	1 cut(s)	638
Psp124BI	GAGCTC	1 cut(s)	3168
Psp1406I	AACGTT	1 cut(s)	3082
Psp6I	CCWGG	6 cut(s)	1129, 1234, 1381, 1396, 2511, 3007
PspFI	CCCAGC	2 cut(s)	86, 1911
PspGI	CCWGG	6 cut(s)	1129, 1234, 1381, 1396, 2511, 3007
PstI	CTGCAG	4 cut(s)	757, 1485, 1611, 1722
PstNI	CAGNNNCTG	3 cut(s)	1480, 1606, 2245
PsuI	RGATCY	6 cut(s)	450, 961, 2572, 2893, 3214, 3367
PvuII	CAGCTG	8 cut(s)	443, 752, 1480, 1606, 1642, 1717, 1958, 2245
RseI	CAYNNNNRTG	4 cut(s)	81, 519, 2864, 3258
SacI	GAGCTC	1 cut(s)	3168
SaqAI	TTAA	3 cut(s)	1406, 1616, 2676
ScaI	AGTACT	1 cut(s)	409
SchI	GAGTC	6 cut(s)	283, 603, 920, 1618, 1964, 2876
ScrFI	CCNGG	7 cut(s)	1131, 1236, 1383, 1398, 2513, 3009, 3145
SduI	GDGCHC	3 cut(s)	3017, 3168, 3436
SfaNI	GCATC	7 cut(s)	173, 613, 1125, 2308, 2370, 2731, 3028
SfcI	CTRYAG	5 cut(s)	753, 1481, 1607, 1718, 2234
SfoI	GGCGCC	1 cut(s)	2988
SfuI	TTCGAA	2 cut(s)	215, 2632
SinI	GGWCC	3 cut(s)	1811, 2474, 2668
SmiMI	CAYNNNNRTG	4 cut(s)	81, 519, 2864, 3258
SmlI	CTYRAG	3 cut(s)	138, 347, 1701
SmoI	CTYRAG	3 cut(s)	138, 347, 1701
SphI	GCATGC	3 cut(s)	80, 733, 883
SseBI	AGGCCT	1 cut(s)	1707
SsiI	CCGC	6 cut(s)	549, 2069, 2225, 2319, 2582, 3184
SspDI	GGCGCC	1 cut(s)	2986
SspMI	CTAG	8 cut(s)	396, 464, 1038, 2592, 2745, 3018, 3179, 3209
SstI	GAGCTC	1 cut(s)	3168
StuI	AGGCCT	1 cut(s)	1707
StyD4I	CCNGG	7 cut(s)	1129, 1234, 1381, 1396, 2511, 3007, 3143
StyI	CCWWGG	2 cut(s)	1184, 1314
TaiI	ACGT	2 cut(s)	3085, 3095
TaqI	TCGA	3 cut(s)	215, 1226, 2632
TatI	WGTACW	4 cut(s)	407, 843, 2095, 3343
TauI	GCSGC	3 cut(s)	552, 2071, 2227
TfiI	GAWTC	6 cut(s)	885, 1016, 1148, 1498, 2542, 2634
Tru1I	TTAA	3 cut(s)	1406, 1616, 2676
Tru9I	TTAA	3 cut(s)	1406, 1616, 2676
TscAI	CASTG	8 cut(s)	727, 949, 1259, 2583, 2701, 3126, 3409, 3421
TseFI	GTSAC	5 cut(s)	241, 398, 1456, 1764, 2106
Tsp45I	GTSAC	5 cut(s)	241, 398, 1456, 1764, 2106
TspGWI	ACGGA	3 cut(s)	197, 2814, 3276
TspRI	CASTG	8 cut(s)	727, 949, 1259, 2583, 2701, 3126, 3409, 3421
Van91I	CCANNNNNTGG	2 cut(s)	1185, 1190
VpaK11BI	GGWCC	3 cut(s)	1811, 2474, 2668
VspI	ATTAAT	1 cut(s)	1616
XapI	RAATTY	6 cut(s)	741, 1213, 1369, 1843, 1939, 1977
XbaI	TCTAGA	1 cut(s)	463
XceI	RCATGY	7 cut(s)	80, 254, 733, 883, 2396, 2998, 3190
XcmI	CCANNNNNNNNNTGG	4 cut(s)	872, 1458, 1955, 3401
XmiI	GTMKAC	2 cut(s)	860, 3095
XmnI	GAANNNNTTC	4 cut(s)	452, 1166, 1943, 2449
XspI	CTAG	8 cut(s)	396, 464, 1038, 2592, 2745, 3018, 3179, 3209
ZrmI	AGTACT	1 cut(s)	409
Zsp2I	ATGCAT	2 cut(s)	735, 3427

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.