Rmu_sc0039330.1_g000001

Glutathione S-transferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039330.1
Physical Location & Seq
Forward (+)
1 .. 825
825 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039330.1_g000001.1.cds

Sequence Viewer

Length: 174 bp
atacatggtttggggaggaagacatggacaactaaggcagacgaacatgtggcagcaaagaaggaatacattgactgcattaagttgctagaagtggagcttggggacaagccttcctttggcggcgagaccctcggatttcttttgcttctgcagttgtatgaccaagattga

Protein Analysis

57

Amino Acids

6.42

Weight (kDa)

5.19

Isoelectric Point (pI)

13.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 123
AfiI CCNNNNNNNGG 1 cut(s) 119
AflIII ACRYGT 1 cut(s) 46
AjuI GAANNNNNNNTTGG 2 cut(s) 84, 116
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
Alw26I GTCTC 1 cut(s) 122
ApeKI GCWGC 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 26
BbvI GCAGC 1 cut(s) 65
BcoDI GTCTC 1 cut(s) 122
BfaI CTAG 1 cut(s) 89
BfmI CTRYAG 1 cut(s) 152
BisI GCNGC 2 cut(s) 54, 124
BlsI GCNGC 2 cut(s) 55, 125
BpiI GAAGAC 1 cut(s) 26
BsaI GGTCTC 1 cut(s) 122
BsaJI CCNNGG 1 cut(s) 133
Bsc4I CCNNNNNNNGG 1 cut(s) 119
BseDI CCNNGG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 119
BseXI GCAGC 1 cut(s) 65
BslFI GGGAC 1 cut(s) 119
BslI CCNNNNNNNGG 1 cut(s) 119
BsmAI GTCTC 1 cut(s) 122
BsmFI GGGAC 1 cut(s) 119
Bso31I GGTCTC 1 cut(s) 122
BspACI CCGC 1 cut(s) 123
BspMAI CTGCAG 1 cut(s) 156
BspTNI GGTCTC 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 133
BstDEI CTNAG 1 cut(s) 33
BstMAI GTCTC 1 cut(s) 122
BstNSI RCATGY 1 cut(s) 50
BstSFI CTRYAG 1 cut(s) 152
BstV1I GCAGC 1 cut(s) 65
BstV2I GAAGAC 1 cut(s) 26
CviAII CATG 3 cut(s) 5, 24, 47
CviJI RGCY 2 cut(s) 100, 112
CviKI_1 RGCY 2 cut(s) 100, 112
DdeI CTNAG 1 cut(s) 33
Eco31I GGTCTC 1 cut(s) 122
FaeI CATG 3 cut(s) 8, 27, 50
FaiI YATR 4 cut(s) 6, 25, 48, 162
FalI AAGNNNNNCTT 4 cut(s) 84, 116, 101, 133
FaqI GGGAC 1 cut(s) 119
FatI CATG 3 cut(s) 4, 23, 46
Fnu4HI GCNGC 2 cut(s) 54, 124
Fsp4HI GCNGC 2 cut(s) 54, 124
FspBI CTAG 1 cut(s) 89
GluI GCNGC 2 cut(s) 54, 124
Hin1II CATG 3 cut(s) 8, 27, 50
Hpy188I TCNGA 1 cut(s) 137
HpyAV CCTTC 2 cut(s) 55, 123
HpyCH4V TGCA 2 cut(s) 78, 154
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 3 cut(s) 8, 27, 50
LmnI GCTCC 1 cut(s) 97
Lsp1109I GCAGC 1 cut(s) 65
MaeI CTAG 1 cut(s) 89
MboII GAAGA 1 cut(s) 31
MnlI CCTC 2 cut(s) 9, 143
MseI TTAA 1 cut(s) 81
NlaIII CATG 3 cut(s) 8, 27, 50
NspI RCATGY 1 cut(s) 50
PciI ACATGT 1 cut(s) 46
PkrI GCNGC 2 cut(s) 55, 125
PscI ACATGT 1 cut(s) 46
PstI CTGCAG 1 cut(s) 156
SaqAI TTAA 1 cut(s) 81
SatI GCNGC 2 cut(s) 54, 124
SetI ASST 1 cut(s) 102
SfcI CTRYAG 1 cut(s) 152
SgeI CNNG 8 cut(s) 17, 36, 59, 101, 113, 121, 139, 146
SsiI CCGC 1 cut(s) 123
SspMI CTAG 1 cut(s) 89
TauI GCSGC 1 cut(s) 126
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TseI GCWGC 1 cut(s) 53
XceI RCATGY 1 cut(s) 50
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.