Rmu_sc0039744.1_g000001

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039744.1
Physical Location & Seq
Reverse (-)
2 .. 159
158 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039744.1_g000001.1.cds

Sequence Viewer

Length: 158 bp
atgagtagcataggaacaggctacgatctctcagtcaccacattttctcctgatggccgtgtattccagattgagtacgcaaccaaagctgttgacaactccgggactgttattgggatcaaatgcaaggatggagttgttatgggtgtggaaaagct

Protein Analysis

53

Amino Acids

5.59

Weight (kDa)

4.93

Isoelectric Point (pI)

32.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 125
AcoI YGGCCR 1 cut(s) 55
AfaI GTAC 1 cut(s) 77
AluBI AGCT 2 cut(s) 89, 157
AluI AGCT 2 cut(s) 89, 157
AlwI GGATC 1 cut(s) 125
AoxI GGCC 1 cut(s) 55
AsuC2I CCSGG 1 cut(s) 103
AsuHPI GGTGA 1 cut(s) 28
BccI CCATC 2 cut(s) 47, 125
BceAI ACGGC 1 cut(s) 42
BcnI CCSGG 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 103
BmrFI CCNGG 1 cut(s) 103
BpuMI CCSGG 1 cut(s) 103
BsaXI ACNNNNNCTCC 2 cut(s) 31, 61
BseGI GGATG 1 cut(s) 136
BseMII CTCAG 1 cut(s) 45
BshFI GGCC 1 cut(s) 57
BsiSI CCGG 1 cut(s) 102
BslFI GGGAC 1 cut(s) 118
BsmFI GGGAC 1 cut(s) 118
BsnI GGCC 1 cut(s) 57
Bsp143I GATC 2 cut(s) 25, 117
BspANI GGCC 1 cut(s) 57
BspCNI CTCAG 1 cut(s) 44
BspPI GGATC 1 cut(s) 125
BssMI GATC 2 cut(s) 25, 117
Bst4CI ACNGT 1 cut(s) 109
BstDEI CTNAG 1 cut(s) 31
BstF5I GGATG 1 cut(s) 136
BstKTI GATC 2 cut(s) 28, 120
BstMBI GATC 2 cut(s) 25, 117
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstSCI CCNGG 1 cut(s) 101
BsuRI GGCC 1 cut(s) 57
BtsCI GGATG 1 cut(s) 136
Csp6I GTAC 1 cut(s) 76
CviJI RGCY 4 cut(s) 21, 57, 89, 157
CviKI_1 RGCY 4 cut(s) 21, 57, 89, 157
CviQI GTAC 1 cut(s) 76
DdeI CTNAG 1 cut(s) 31
DpnI GATC 2 cut(s) 27, 119
DpnII GATC 2 cut(s) 25, 117
EaeI YGGCCR 1 cut(s) 55
FaiI YATR 2 cut(s) 11, 143
FaqI GGGAC 1 cut(s) 118
FokI GGATG 1 cut(s) 143
HaeIII GGCC 1 cut(s) 57
HapII CCGG 1 cut(s) 102
HincII GTYRAC 1 cut(s) 94
HindII GTYRAC 1 cut(s) 94
HpaII CCGG 1 cut(s) 102
HphI GGTGA 1 cut(s) 28
Hpy166II GTNNAC 1 cut(s) 94
Hpy188III TCNNGA 2 cut(s) 50, 67
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 126
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 31
Kzo9I GATC 2 cut(s) 25, 117
LpnPI CCDG 4 cut(s) 3, 63, 80, 115
MaeIII GTNAC 1 cut(s) 34
MalI GATC 2 cut(s) 27, 119
MboI GATC 2 cut(s) 25, 117
MspI CCGG 1 cut(s) 102
MspR9I CCNGG 1 cut(s) 103
MwoI GCNNNNNNNGC 1 cut(s) 86
NciI CCSGG 1 cut(s) 103
NdeII GATC 2 cut(s) 25, 117
NmuCI GTSAC 1 cut(s) 34
PfoI TCCNGGA 1 cut(s) 101
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
Sau3AI GATC 2 cut(s) 25, 117
ScrFI CCNGG 1 cut(s) 103
SetI ASST 1 cut(s) 91
SgeI CNNG 7 cut(s) 30, 62, 71, 79, 114, 115, 139
StyD4I CCNGG 1 cut(s) 101
TaaI ACNGT 1 cut(s) 109
TseFI GTSAC 1 cut(s) 34
Tsp45I GTSAC 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.