Rmu_sc0040617.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040617.1
Physical Location & Seq
Reverse (-)
2010 .. 2315
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040617.1_g000001.1.cds

Sequence Viewer

Length: 306 bp
atggaagataaactattgttggatttcttcagggaagaattgggtgcacaaagaaattatcaaacagatgatgggtttaattgggagatcgttagcaaagcaaaagcttggattagtgaggaaaatactggaccctttgagtggggacttgaccacaagaaagaagcctttgttagagatatgcataaaggagggaagtggcttaacaagtttgaggatgagaaagaggagttggctttacaaatcgagactgccgtgcttgagttcttggtggatgagctttcggttgatctcttattgagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.93

Weight (kDa)

4.54

Isoelectric Point (pI)

40.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012879)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 13
AfiI CCNNNNNNNGG 1 cut(s) 141
AjuI GAANNNNNNNTTGG 2 cut(s) 215, 247
AluBI AGCT 2 cut(s) 107, 280
AluI AGCT 2 cut(s) 107, 280
Alw21I GWGCWC 1 cut(s) 49
Alw26I GTCTC 1 cut(s) 242
Alw44I GTGCAC 1 cut(s) 45
ApaLI GTGCAC 1 cut(s) 45
AspS9I GGNCC 1 cut(s) 131
AvaII GGWCC 1 cut(s) 131
BaeGI GKGCMC 1 cut(s) 49
Bbv12I GWGCWC 1 cut(s) 49
BccI CCATC 1 cut(s) 65
BceAI ACGGC 1 cut(s) 239
BcoDI GTCTC 1 cut(s) 242
Bme18I GGWCC 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 131
BmiI GGNNCC 1 cut(s) 133
BpuEI CTTGAG 1 cut(s) 281
Bsc4I CCNNNNNNNGG 1 cut(s) 141
Bse1I ACTGG 1 cut(s) 133
BseGI GGATG 2 cut(s) 223, 280
BseLI CCNNNNNNNGG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 133
BseRI GAGGAG 1 cut(s) 242
BseSI GKGCMC 1 cut(s) 49
BsiHKAI GWGCWC 1 cut(s) 49
BslFI GGGAC 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 141
BsmAI GTCTC 1 cut(s) 242
BsmFI GGGAC 1 cut(s) 159
Bsp1286I GDGCHC 1 cut(s) 49
Bsp143I GATC 2 cut(s) 87, 289
BspLI GGNNCC 1 cut(s) 133
BsrI ACTGG 1 cut(s) 133
BssMI GATC 2 cut(s) 87, 289
BstF5I GGATG 2 cut(s) 223, 280
BstKTI GATC 2 cut(s) 90, 292
BstMAI GTCTC 1 cut(s) 242
BstMBI GATC 2 cut(s) 87, 289
BstSLI GKGCMC 1 cut(s) 49
BtsCI GGATG 2 cut(s) 223, 280
Cfr13I GGNCC 1 cut(s) 131
CviJI RGCY 5 cut(s) 107, 167, 202, 236, 280
CviKI_1 RGCY 5 cut(s) 107, 167, 202, 236, 280
DpnI GATC 2 cut(s) 89, 291
DpnII GATC 2 cut(s) 87, 289
Eco47I GGWCC 1 cut(s) 131
Eco57I CTGAAG 1 cut(s) 13
EcoT22I ATGCAT 1 cut(s) 186
FaiI YATR 2 cut(s) 182, 186
FaqI GGGAC 1 cut(s) 159
FokI GGATG 2 cut(s) 230, 287
HindIII AAGCTT 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 47
Hpy188III TCNNGA 1 cut(s) 247
Hpy8I GTNNAC 1 cut(s) 47
HpyCH4V TGCA 2 cut(s) 47, 184
Kzo9I GATC 2 cut(s) 87, 289
LpnPI CCDG 2 cut(s) 16, 114
MalI GATC 2 cut(s) 89, 291
MboI GATC 2 cut(s) 87, 289
MboII GAAGA 3 cut(s) 17, 19, 47
MhlI GDGCHC 1 cut(s) 49
MluCI AATT 3 cut(s) 38, 55, 79
MnlI CCTC 4 cut(s) 112, 185, 208, 220
Mph1103I ATGCAT 1 cut(s) 186
MseI TTAA 2 cut(s) 78, 204
NdeII GATC 2 cut(s) 87, 289
NlaIV GGNNCC 1 cut(s) 133
NsiI ATGCAT 1 cut(s) 186
PcsI WCGNNNNNNNCGW 1 cut(s) 252
PspN4I GGNNCC 1 cut(s) 133
PspPI GGNCC 1 cut(s) 131
SaqAI TTAA 2 cut(s) 78, 204
Sau3AI GATC 2 cut(s) 87, 289
Sau96I GGNCC 1 cut(s) 131
SduI GDGCHC 1 cut(s) 49
SetI ASST 2 cut(s) 109, 282
SinI GGWCC 1 cut(s) 131
SmlI CTYRAG 1 cut(s) 260
SmoI CTYRAG 1 cut(s) 260
Sse9I AATT 3 cut(s) 38, 55, 79
TaqI TCGA 1 cut(s) 246
TasI AATT 3 cut(s) 38, 55, 79
Tru1I TTAA 2 cut(s) 78, 204
Tru9I TTAA 2 cut(s) 78, 204
VneI GTGCAC 1 cut(s) 45
VpaK11BI GGWCC 1 cut(s) 131
Zsp2I ATGCAT 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.