Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0041034.1

Orthogroup ID

OG0013654

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1439

Gene Structure 1439 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0041034.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 715 bp

aagtggacctccgaaggtgatggttctgactgttggctctgcgagttggagacatattggggattctgttatgtgcaattttgaccatcagtcaggaatttatcttaatggatgtcttcattggataggtctacccactcagggttctcattttatatatgcgtttgacattgaaagtgagtgtttccaacagatacatctacctccttttattttggataacaagataactaaatgtaaccttggagttgtgaacgggtgcctctctataactgttccttcaagttataatttcacagtttgggtgatgaaggatcatggtgttaagaagccttggactaaagagcttgatattaaagtggatttgcatttagggtgtggttcttcaactcaagttctgaaatcttcaaaggaacggaaagtcttgttgttacagaataggttgcaggctcatattcctggaagaaggggctttatgggggttggggttgatgggataccatctttgattgacgcatcatatctctatgttccaagctttatttcacttaaagatgtctttggggggccaggtaatgtgaaagctaatgcagcggattatgggaatgctgaagcagcccagcggaatcttctacataaagctaatggattagatcaagggaatgtgcaatctaaagctgcagtagttgaacacaaacaacaggtaactggttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

237

Amino Acids

25.83

Weight (kDa)

8.7

Isoelectric Point (pI)

35.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013654)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g13040 FvH4_4g13060
malus_domestica	MD04G1020200.v1.1
rosa_chinensis	RchiOBHm_Chr4g0412781 RchiOBHm_Chr4g0412791
rosa_laevigata	RLG00000008259
rosa_multiflora	Rmu_sc0001238.1_g000047 Rmu_sc0001569.1_g000012 Rmu_sc0041034.1_g000001
rosa_roxburghii	Rroxscaffold_5G00357040
rosa_rugosa	Rorug04G0116800
rosa_samantha	Rh4AG175500 Rh4BG175300 Rh4BG175400 Rh4CG186700 Rh4DG172300 Rh6CG426300
rosa_wichuraiana	Rw4G014730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	289
AccB1I	GGYRCC	1 cut(s)	259
AccI	GTMKAC	1 cut(s)	131
AciI	CCGC	2 cut(s)	594, 623
AclWI	GGATC	1 cut(s)	322
AcsI	RAATTY	1 cut(s)	97
AcuI	CTGAAG	1 cut(s)	631
AfiI	CCNNNNNNNGG	1 cut(s)	141
AgsI	TTSAA	5 cut(s)	174, 283, 388, 409, 690
AhdI	GACNNNNNGTC	1 cut(s)	89
AjnI	CCWGG	2 cut(s)	458, 569
AjuI	GAANNNNNNNTTGG	2 cut(s)	527, 559
AluBI	AGCT	5 cut(s)	347, 538, 585, 642, 678
AluI	AGCT	5 cut(s)	347, 538, 585, 642, 678
Alw26I	GTCTC	1 cut(s)	44
AlwI	GGATC	1 cut(s)	322
AoxI	GGCC	1 cut(s)	567
ApeKI	GCWGC	3 cut(s)	591, 615, 678
ApoI	RAATTY	1 cut(s)	97
AspS9I	GGNCC	2 cut(s)	6, 567
AsuHPI	GGTGA	2 cut(s)	29, 317
AvaII	GGWCC	1 cut(s)	6
BanI	GGYRCC	1 cut(s)	259
BbsI	GAAGAC	1 cut(s)	108
BbvI	GCAGC	3 cut(s)	603, 627, 665
BccI	CCATC	4 cut(s)	14, 94, 486, 509
BciT130I	CCWGG	2 cut(s)	460, 571
BciVI	GTATCC	1 cut(s)	490
BcoDI	GTCTC	1 cut(s)	44
BfmI	CTRYAG	1 cut(s)	679
BfuI	GTATCC	1 cut(s)	490
BisI	GCNGC	3 cut(s)	592, 616, 679
BlsI	GCNGC	3 cut(s)	593, 617, 680
Bme1390I	CCNGG	2 cut(s)	460, 571
Bme18I	GGWCC	1 cut(s)	6
BmeRI	GACNNNNNGTC	1 cut(s)	89
BmgT120I	GGNCC	2 cut(s)	6, 567
BmiI	GGNNCC	2 cut(s)	261, 568
BmrFI	CCNGG	2 cut(s)	460, 571
BmsI	GCATC	1 cut(s)	525
BpiI	GAAGAC	1 cut(s)	108
BpuEI	CTTGAG	1 cut(s)	376
BsaJI	CCNNGG	2 cut(s)	242, 333
Bsc4I	CCNNNNNNNGG	1 cut(s)	141
Bse1I	ACTGG	1 cut(s)	713
BseBI	CCWGG	2 cut(s)	460, 571
BseDI	CCNNGG	2 cut(s)	242, 333
BseGI	GGATG	1 cut(s)	117
BseLI	CCNNNNNNNGG	1 cut(s)	141
BseMII	CTCAG	1 cut(s)	153
BseNI	ACTGG	1 cut(s)	713
BseXI	GCAGC	3 cut(s)	603, 627, 665
BseYI	CCCAGC	1 cut(s)	619
BshFI	GGCC	1 cut(s)	569
BshNI	GGYRCC	1 cut(s)	259
BslI	CCNNNNNNNGG	1 cut(s)	141
BsmAI	GTCTC	1 cut(s)	44
BsmI	GAATGC	1 cut(s)	611
BsnI	GGCC	1 cut(s)	569
Bsp143I	GATC	2 cut(s)	314, 653
BspACI	CCGC	2 cut(s)	594, 623
BspANI	GGCC	1 cut(s)	569
BspCNI	CTCAG	1 cut(s)	152
BspLI	GGNNCC	2 cut(s)	261, 568
BspMAI	CTGCAG	1 cut(s)	683
BspPI	GGATC	1 cut(s)	322
BspT107I	GGYRCC	1 cut(s)	259
BsrI	ACTGG	1 cut(s)	713
BssECI	CCNNGG	2 cut(s)	242, 333
BssMI	GATC	2 cut(s)	314, 653
BssT1I	CCWWGG	2 cut(s)	242, 333
Bst2UI	CCWGG	2 cut(s)	460, 571
Bst4CI	ACNGT	3 cut(s)	32, 275, 299
BstC8I	GCNNGC	1 cut(s)	448
BstDEI	CTNAG	1 cut(s)	139
BstF5I	GGATG	1 cut(s)	117
BstKTI	GATC	2 cut(s)	317, 656
BstMAI	GTCTC	1 cut(s)	44
BstMBI	GATC	2 cut(s)	314, 653
BstMWI	GCNNNNNNNGC	2 cut(s)	591, 615
BstNI	CCWGG	2 cut(s)	460, 571
BstSCI	CCNGG	2 cut(s)	458, 569
BstSFI	CTRYAG	1 cut(s)	679
BstV1I	GCAGC	3 cut(s)	603, 627, 665
BstV2I	GAAGAC	1 cut(s)	108
BsuI	GTATCC	1 cut(s)	490
BsuRI	GGCC	1 cut(s)	569
BtsCI	GGATG	1 cut(s)	117
Cac8I	GCNNGC	1 cut(s)	448
Cfr13I	GGNCC	2 cut(s)	6, 567
CseI	GACGC	1 cut(s)	522
CviAII	CATG	1 cut(s)	318
DdeI	CTNAG	1 cut(s)	139
DpnI	GATC	2 cut(s)	316, 655
DpnII	GATC	2 cut(s)	314, 653
DriI	GACNNNNNGTC	1 cut(s)	89
Eam1105I	GACNNNNNGTC	1 cut(s)	89
Eco130I	CCWWGG	2 cut(s)	242, 333
Eco47I	GGWCC	1 cut(s)	6
Eco57I	CTGAAG	1 cut(s)	631
EcoRII	CCWGG	2 cut(s)	458, 569
EcoT14I	CCWWGG	2 cut(s)	242, 333
ErhI	CCWWGG	2 cut(s)	242, 333
FaeI	CATG	1 cut(s)	321
FatI	CATG	1 cut(s)	317
FblI	GTMKAC	1 cut(s)	131
Fnu4HI	GCNGC	3 cut(s)	592, 616, 679
FokI	GGATG	1 cut(s)	124
Fsp4HI	GCNGC	3 cut(s)	592, 616, 679
GluI	GCNGC	3 cut(s)	592, 616, 679
GsaI	CCCAGC	1 cut(s)	623
HaeIII	GGCC	1 cut(s)	569
HgaI	GACGC	1 cut(s)	522
Hin1II	CATG	1 cut(s)	321
HindIII	AAGCTT	1 cut(s)	536
HinfI	GANTC	2 cut(s)	63, 626
HphI	GGTGA	2 cut(s)	29, 317
Hpy166II	GTNNAC	3 cut(s)	6, 132, 254
Hpy188I	TCNGA	3 cut(s)	13, 28, 400
Hpy188III	TCNNGA	1 cut(s)	94
Hpy8I	GTNNAC	3 cut(s)	6, 132, 254
HpyAV	CCTTC	4 cut(s)	8, 289, 305, 460
HpyCH4III	ACNGT	3 cut(s)	32, 275, 299
HpyCH4V	TGCA	6 cut(s)	76, 368, 446, 591, 668, 681
HpyF10VI	GCNNNNNNNGC	2 cut(s)	591, 615
HpyF3I	CTNAG	1 cut(s)	139
Hsp92II	CATG	1 cut(s)	321
Kzo9I	GATC	2 cut(s)	314, 653
Lsp1109I	GCAGC	3 cut(s)	603, 627, 665
LweI	GCATC	1 cut(s)	525
MaeIII	GTNAC	3 cut(s)	237, 430, 704
MalI	GATC	2 cut(s)	316, 655
MboI	GATC	2 cut(s)	314, 653
MboII	GAAGA	5 cut(s)	108, 376, 397, 475, 621
MluCI	AATT	3 cut(s)	77, 97, 290
MmeI	TCCRAC	2 cut(s)	27, 212
MnlI	CCTC	3 cut(s)	19, 214, 273
MseI	TTAA	4 cut(s)	106, 325, 355, 550
MspA1I	CMGCKG	2 cut(s)	594, 623
MspR9I	CCNGG	2 cut(s)	460, 571
Mva1269I	GAATGC	1 cut(s)	611
MvaI	CCWGG	2 cut(s)	460, 571
MwoI	GCNNNNNNNGC	2 cut(s)	591, 615
NdeII	GATC	2 cut(s)	314, 653
NlaIII	CATG	1 cut(s)	321
NlaIV	GGNNCC	2 cut(s)	261, 568
PctI	GAATGC	1 cut(s)	611
PfeI	GAWTC	2 cut(s)	63, 626
PfoI	TCCNGGA	1 cut(s)	458
PkrI	GCNGC	3 cut(s)	593, 617, 680
PsiI	TTATAA	1 cut(s)	289
Psp6I	CCWGG	2 cut(s)	458, 569
PspFI	CCCAGC	1 cut(s)	619
PspGI	CCWGG	2 cut(s)	458, 569
PspN4I	GGNNCC	2 cut(s)	261, 568
PspPI	GGNCC	2 cut(s)	6, 567
PstI	CTGCAG	1 cut(s)	683
SaqAI	TTAA	4 cut(s)	106, 325, 355, 550
SatI	GCNGC	3 cut(s)	592, 616, 679
Sau3AI	GATC	2 cut(s)	314, 653
Sau96I	GGNCC	2 cut(s)	6, 567
ScrFI	CCNGG	2 cut(s)	460, 571
SfaNI	GCATC	1 cut(s)	525
SfcI	CTRYAG	1 cut(s)	679
SinI	GGWCC	1 cut(s)	6
SmlI	CTYRAG	1 cut(s)	391
SmoI	CTYRAG	1 cut(s)	391
Sse9I	AATT	3 cut(s)	77, 97, 290
SsiI	CCGC	2 cut(s)	594, 623
StyD4I	CCNGG	2 cut(s)	458, 569
StyI	CCWWGG	2 cut(s)	242, 333
TaaI	ACNGT	3 cut(s)	32, 275, 299
TasI	AATT	3 cut(s)	77, 97, 290
TfiI	GAWTC	2 cut(s)	63, 626
Tru1I	TTAA	4 cut(s)	106, 325, 355, 550
Tru9I	TTAA	4 cut(s)	106, 325, 355, 550
TseI	GCWGC	3 cut(s)	591, 615, 678
TspDTI	ATGAA	2 cut(s)	108, 324
TspGWI	ACGGA	1 cut(s)	431
VpaK11BI	GGWCC	1 cut(s)	6
XapI	RAATTY	1 cut(s)	97
XmiI	GTMKAC	1 cut(s)	131

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.