Rmu_sc0041759.1_g000001

La protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041759.1
Physical Location & Seq
Reverse (-)
2 .. 546
545 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041759.1_g000001.1.cds

Sequence Viewer

Length: 306 bp
atggcttccctcagcgaagaaaccgcgaagaaagttcttcgacaggttgagttctacttcagcgatagcaatcttccgagagacgattttctgaagaagtcgataagcgaaagcgaggatgggatgattagcttggctttgatatgctcgtttagtcggatgagaggtcatctcagtttgggggatttgaaggccgacgctatccctgaagatagcgttaaagctgttgctgaaactcttagaaaatctaccactctcaagatttccgaagacgggcaaaaggttggtagggctacagaaatcttg

Protein Analysis

102

Amino Acids

11.25

Weight (kDa)

5.41

Isoelectric Point (pI)

42.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011399)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 26
AciI CCGC 1 cut(s) 24
AcuI CTGAAG 3 cut(s) 43, 113, 228
AfiI CCNNNNNNNGG 1 cut(s) 273
AgsI TTSAA 1 cut(s) 190
AluBI AGCT 2 cut(s) 132, 224
AluI AGCT 2 cut(s) 132, 224
Alw26I GTCTC 1 cut(s) 75
AoxI GGCC 1 cut(s) 192
BbsI GAAGAC 1 cut(s) 276
BbvCI CCTCAGC 1 cut(s) 11
BccI CCATC 1 cut(s) 113
BcoDI GTCTC 1 cut(s) 75
BfmI CTRYAG 1 cut(s) 294
BpiI GAAGAC 1 cut(s) 276
BplI GAGNNNNNCTC 2 cut(s) 156, 188
Bpu10I CCTNAGC 1 cut(s) 11
BpuEI CTTGAG 1 cut(s) 242
BsaBI GATNNNNATC 1 cut(s) 69
Bsc4I CCNNNNNNNGG 1 cut(s) 273
Bse8I GATNNNNATC 1 cut(s) 69
BseGI GGATG 3 cut(s) 124, 129, 165
BseJI GATNNNNATC 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 273
BseMII CTCAG 2 cut(s) 25, 187
Bsh1236I CGCG 1 cut(s) 26
BshFI GGCC 1 cut(s) 194
BslI CCNNNNNNNGG 1 cut(s) 273
BsmAI GTCTC 1 cut(s) 75
BsmBI CGTCTC 1 cut(s) 75
BsnI GGCC 1 cut(s) 194
BspACI CCGC 1 cut(s) 24
BspANI GGCC 1 cut(s) 194
BspCNI CTCAG 2 cut(s) 24, 186
BspFNI CGCG 1 cut(s) 26
BstDEI CTNAG 3 cut(s) 11, 173, 239
BstF5I GGATG 3 cut(s) 124, 129, 165
BstFNI CGCG 1 cut(s) 26
BstMAI GTCTC 1 cut(s) 75
BstSFI CTRYAG 1 cut(s) 294
BstUI CGCG 1 cut(s) 26
BstV2I GAAGAC 1 cut(s) 276
BsuRI GGCC 1 cut(s) 194
BtsCI GGATG 3 cut(s) 124, 129, 165
CseI GACGC 1 cut(s) 206
CviJI RGCY 6 cut(s) 5, 132, 137, 194, 224, 293
CviKI_1 RGCY 6 cut(s) 5, 132, 137, 194, 224, 293
DdeI CTNAG 3 cut(s) 11, 173, 239
Eco57I CTGAAG 3 cut(s) 43, 113, 228
Esp3I CGTCTC 1 cut(s) 75
FaiI YATR 1 cut(s) 145
FokI GGATG 3 cut(s) 131, 136, 172
HaeIII GGCC 1 cut(s) 194
HgaI GACGC 1 cut(s) 206
Hpy188I TCNGA 4 cut(s) 78, 93, 159, 268
Hpy188III TCNNGA 1 cut(s) 259
Hpy99I CGWCG 1 cut(s) 200
HpyAV CCTTC 1 cut(s) 184
HpyF3I CTNAG 3 cut(s) 11, 173, 239
LpnPI CCDG 2 cut(s) 29, 219
MboII GAAGA 7 cut(s) 29, 29, 40, 65, 106, 221, 281
MmeI TCCRAC 1 cut(s) 137
MnlI CCTC 3 cut(s) 20, 109, 158
MseI TTAA 1 cut(s) 219
MvnI CGCG 1 cut(s) 26
SaqAI TTAA 1 cut(s) 219
SetI ASST 5 cut(s) 48, 134, 169, 226, 285
SfcI CTRYAG 1 cut(s) 294
SgeI CNNG 9 cut(s) 37, 56, 90, 127, 145, 160, 218, 271, 286
SmlI CTYRAG 1 cut(s) 257
SmoI CTYRAG 1 cut(s) 257
SsiI CCGC 1 cut(s) 24
TaqI TCGA 2 cut(s) 40, 101
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.