Rmu_sc0041887.1_g000001

Nitrate reductase is a key enzyme involved in the first step of nitrate assimilation in plants, fungi and bacteria

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041887.1
Physical Location & Seq
Reverse (-)
1 .. 519
519 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041887.1_g000001.1.cds

Sequence Viewer

Length: 261 bp
atgagtagtacgtgttgcgtttttacaggagggggtaagaaagtgacacgagtggaggtgactctagacggtggggagacctggcacgtctgcaatctggaccaccaagagaagccgaacaaatatgggaaatactggtgctggtgcttctggtcactggacgtggaagtgctcaacttactggtagccaaagagattgcggtgagggcttgggacgaaacccacaacactcagcccgaaaagctcatctggaatgtcatg

Protein Analysis

87

Amino Acids

10.07

Weight (kDa)

5.85

Isoelectric Point (pI)

27.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010866)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 200
AfaI GTAC 1 cut(s) 10
AflIII ACRYGT 1 cut(s) 11
AjiI CACGTC 2 cut(s) 88, 163
AjnI CCWGG 1 cut(s) 80
AluBI AGCT 1 cut(s) 244
AluI AGCT 1 cut(s) 244
Alw21I GWGCWC 1 cut(s) 174
Alw26I GTCTC 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 100
AsuHPI GGTGA 2 cut(s) 70, 214
AvaII GGWCC 1 cut(s) 100
BauI CACGAG 1 cut(s) 48
Bbv12I GWGCWC 1 cut(s) 174
BciT130I CCWGG 1 cut(s) 82
BcoDI GTCTC 1 cut(s) 71
BfaI CTAG 1 cut(s) 65
Bme1390I CCNGG 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 100
BmgBI CACGTC 2 cut(s) 88, 163
BmgT120I GGNCC 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 82
BsaAI YACGTR 1 cut(s) 12
BsaI GGTCTC 1 cut(s) 71
Bse1I ACTGG 3 cut(s) 140, 162, 186
BseBI CCWGG 1 cut(s) 82
BseMII CTCAG 1 cut(s) 245
BseNI ACTGG 3 cut(s) 140, 162, 186
BsiHKAI GWGCWC 1 cut(s) 174
BslFI GGGAC 1 cut(s) 227
BsmAI GTCTC 1 cut(s) 71
BsmFI GGGAC 1 cut(s) 227
Bso31I GGTCTC 1 cut(s) 71
Bsp1286I GDGCHC 1 cut(s) 174
BspACI CCGC 1 cut(s) 200
BspCNI CTCAG 1 cut(s) 244
BspTNI GGTCTC 1 cut(s) 71
BsrI ACTGG 3 cut(s) 140, 162, 186
BssSI CACGAG 1 cut(s) 48
Bst2BI CACGAG 1 cut(s) 48
Bst2UI CCWGG 1 cut(s) 82
Bst4CI ACNGT 1 cut(s) 71
BstBAI YACGTR 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 231
BstMAI GTCTC 1 cut(s) 71
BstMWI GCNNNNNNNGC 2 cut(s) 206, 241
BstNI CCWGG 1 cut(s) 82
BstSCI CCNGG 1 cut(s) 80
BtrI CACGTC 2 cut(s) 88, 163
BtsIMutI CAGTG 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 100
Csp6I GTAC 1 cut(s) 9
CviAII CATG 1 cut(s) 259
CviJI RGCY 5 cut(s) 115, 188, 209, 235, 244
CviKI_1 RGCY 5 cut(s) 115, 188, 209, 235, 244
CviQI GTAC 1 cut(s) 9
DdeI CTNAG 1 cut(s) 231
Eco31I GGTCTC 1 cut(s) 71
Eco47I GGWCC 1 cut(s) 100
EcoRII CCWGG 1 cut(s) 80
FaiI YATR 2 cut(s) 126, 260
FaqI GGGAC 1 cut(s) 227
FspBI CTAG 1 cut(s) 65
HinfI GANTC 1 cut(s) 61
HphI GGTGA 2 cut(s) 70, 214
Hpy188III TCNNGA 3 cut(s) 65, 98, 250
HpyCH4III ACNGT 1 cut(s) 71
HpyCH4IV ACGT 3 cut(s) 11, 87, 162
HpyCH4V TGCA 1 cut(s) 93
HpyF10VI GCNNNNNNNGC 2 cut(s) 206, 241
HpyF3I CTNAG 1 cut(s) 231
HpySE526I ACGT 3 cut(s) 11, 87, 162
MaeI CTAG 1 cut(s) 65
MaeII ACGT 3 cut(s) 11, 87, 162
MaeIII GTNAC 3 cut(s) 43, 58, 153
MhlI GDGCHC 1 cut(s) 174
MlyI GAGTC 1 cut(s) 55
MnlI CCTC 3 cut(s) 23, 49, 198
MspR9I CCNGG 1 cut(s) 82
MvaI CCWGG 1 cut(s) 82
MwoI GCNNNNNNNGC 2 cut(s) 206, 241
NmuCI GTSAC 3 cut(s) 43, 58, 153
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
Ppu21I YACGTR 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 80
PspGI CCWGG 1 cut(s) 80
PspPI GGNCC 1 cut(s) 100
RsaI GTAC 1 cut(s) 10
RsaNI GTAC 1 cut(s) 9
Sau96I GGNCC 1 cut(s) 100
SchI GAGTC 1 cut(s) 55
ScrFI CCNGG 1 cut(s) 82
SduI GDGCHC 1 cut(s) 174
SetI ASST 6 cut(s) 14, 60, 83, 90, 165, 246
SinI GGWCC 1 cut(s) 100
SsiI CCGC 1 cut(s) 200
SspMI CTAG 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 80
TaaI ACNGT 1 cut(s) 71
TaiI ACGT 3 cut(s) 14, 90, 165
TscAI CASTG 1 cut(s) 162
TseFI GTSAC 3 cut(s) 43, 58, 153
Tsp45I GTSAC 3 cut(s) 43, 58, 153
TspRI CASTG 1 cut(s) 162
VpaK11BI GGWCC 1 cut(s) 100
XbaI TCTAGA 1 cut(s) 64
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.