Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000002.1

Orthogroup ID

OG0008370

Physical Location & Seq

Genomic Coordinates Reverse (-)

57304 .. 60962

Gene Structure 3659 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000002.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1377 bp

atgagttacagtgagtttgtggggaggtacatggagaagaaccagcctgtggtgctgacaggtctcatggatgattggagggcttgcagagattgggtcactgatgatggcaaccccaatcttcaatttttcgctacccattttggaaagtccaaagtccaggttgcagattgcggtactagagaatacacggatcagaagagattagaaatgactgttggagaatttgttgagcaatggcgtggggattctgtgcaagagcattgtactgctccaagtcaggcaagtgggagcaagatgttgctatatttgaaggactggcattttgtaaaggagtacccagaatatacagcatacacaactccaatgttcttttgtgatgattggcttaacacatatcttgacaattatcgtatgcataacgaccccaacatttactctgaaaacaatgacataagctgctctgactatcgatttgtttacatgggagcaaaaggcacatggactcctcttcatgctgatgttttcaggtcatatagctggtcagcaaatgtgtgtggaaaaaaacagtggcttttcctgtctccttctcaaagtcatctggtgtttgacaggaatatgaaaaacagtgtatataatatctttgatgatgtcagtgaaacaaaatttcctggttttgcaaaggctatgtggtttgagtgcactcaagagaaaaatgacattatctttgtgcctagtggatggtatcatcaagtccataatttggaagataccatttcaataaaccacaactggttcaatgctaataatcttcgttgggtgtgggatttgcttttgagggactacgatgaggctaaggagtacatagaagacattaagcaaatatgtgatgattttgaaggtctctgccagcgcaaccttgccgctaatacaggcttgaacttcaatgatttcttaatactcctagcacgtctttcctttgccaacttgattcaacttcagtatctcagtaggaagaatgggaatcacactcagaatttatccccaatagctcagcatttcactttcaaccttgtatcaattcagaaaattgcatccagtataagctccttgcaagatctgacaggaagtcatggcttttatttggattttaaggaaacattaaatgatccagggttcattaaactttgtgcagttttgggaaaaacatatgggacgatacacatgcaacaaaactggaattttgatacaaagaaagcttggatagatgatatgaaagacttggacgttataggaacttgtaattctcaggtctgtactcccaaagatcttgtaatgtttatacagcatgctcttgcagaaagcaatggtggttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cupin_8 JmjC

Protein Analysis

458

Amino Acids

53.18

Weight (kDa)

5.23

Isoelectric Point (pI)

36.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008370)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G63080
fragaria_vesca	FvH4_5g05750 FvH4_5g05750 FvH4_5g05750 FvH4_5g05750 FvH4_5g05750 FvH4_5g05750 FvH4_5g05750 FvH4_5g05750
malus_domestica	MD14G1175900.v1.1
prunus_persica	Prupe.5G169900_v2.0.a1
pyrus_communis	pycom14g08050 pycom14g14700
rosa_chinensis	RchiOBHm_Chr7g0193061
rosa_laevigata	RLG00000004298
rosa_multiflora	Rmu_ssc0000002.1_g000011
rosa_roxburghii	Rroxscaffold_3G00262410
rosa_rugosa	Rorug07G0007400
rosa_samantha	Rh7AG132500 Rh7BG133400 Rh7CG136500 Rh7DG134400
rosa_wichuraiana	Rw7G011320

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	49, 763
AciI	CCGC	2 cut(s)	174, 924
AclWI	GGATC	2 cut(s)	201, 1163
AcsI	RAATTY	4 cut(s)	224, 665, 1036, 1240
AcuI	CTGAAG	1 cut(s)	983
AfaI	GTAC	6 cut(s)	29, 178, 268, 338, 863, 1318
AfiI	CCNNNNNNNGG	2 cut(s)	49, 763
AgsI	TTSAA	9 cut(s)	125, 313, 780, 799, 899, 940, 946, 995, 1069
AhdI	GACNNNNNGTC	1 cut(s)	1128
AjiI	CACGTC	1 cut(s)	971
AjnI	CCWGG	3 cut(s)	159, 670, 1171
AjuI	GAANNNNNNNTTGG	2 cut(s)	201, 233
AluBI	AGCT	5 cut(s)	459, 540, 1052, 1107, 1259
AluI	AGCT	5 cut(s)	459, 540, 1052, 1107, 1259
Alw21I	GWGCWC	1 cut(s)	704
Alw26I	GTCTC	3 cut(s)	68, 588, 908
Alw44I	GTGCAC	1 cut(s)	700
AlwI	GGATC	2 cut(s)	201, 1163
ApaLI	GTGCAC	1 cut(s)	700
ApeKI	GCWGC	1 cut(s)	459
ApoI	RAATTY	4 cut(s)	224, 665, 1036, 1240
ArsI	GACNNNNNNTTYG	6 cut(s)	308, 340, 458, 490, 710, 742
AspLEI	GCGC	1 cut(s)	915
BaeGI	GKGCMC	1 cut(s)	704
BaeI	ACNNNNGTAYC	2 cut(s)	986, 1019
BbsI	GAAGAC	1 cut(s)	876
Bbv12I	GWGCWC	1 cut(s)	704
BbvI	GCAGC	1 cut(s)	446
BccI	CCATC	2 cut(s)	101, 735
BcgI	CGANNNNNNTGC	2 cut(s)	1207, 1241
BciT130I	CCWGG	3 cut(s)	161, 672, 1173
BcoDI	GTCTC	3 cut(s)	68, 588, 908
BfaI	CTAG	3 cut(s)	180, 735, 965
BglII	AGATCT	2 cut(s)	1117, 1327
BisI	GCNGC	2 cut(s)	460, 924
BlpI	GCTNAGC	1 cut(s)	1053
BlsI	GCNGC	2 cut(s)	461, 925
Bme1390I	CCNGG	3 cut(s)	161, 672, 1173
BmeRI	GACNNNNNGTC	1 cut(s)	1128
BmgBI	CACGTC	1 cut(s)	971
BmrFI	CCNGG	3 cut(s)	161, 672, 1173
BmsI	GCATC	1 cut(s)	1103
BpiI	GAAGAC	1 cut(s)	876
Bpu10I	CCTNAGC	1 cut(s)	855
Bpu1102I	GCTNAGC	1 cut(s)	1053
BpuEI	CTTGAG	1 cut(s)	690
Bsa29I	ATCGAT	1 cut(s)	472
BsaI	GGTCTC	2 cut(s)	68, 908
BsaJI	CCNNGG	1 cut(s)	1172
BsaXI	ACNNNNNCTCC	4 cut(s)	213, 243, 490, 520
Bsc4I	CCNNNNNNNGG	2 cut(s)	49, 763
Bse1I	ACTGG	4 cut(s)	323, 797, 1098, 1241
Bse3DI	GCAATG	2 cut(s)	242, 1372
BseBI	CCWGG	3 cut(s)	161, 672, 1173
BseCI	ATCGAT	1 cut(s)	472
BseDI	CCNNGG	1 cut(s)	1172
BseGI	GGATG	3 cut(s)	76, 746, 1094
BseLI	CCNNNNNNNGG	2 cut(s)	49, 763
BseMI	GCAATG	2 cut(s)	242, 1372
BseMII	CTCAG	4 cut(s)	1021, 1046, 1067, 1322
BseNI	ACTGG	4 cut(s)	323, 797, 1098, 1241
BseRI	GAGGAG	1 cut(s)	498
BseSI	GKGCMC	1 cut(s)	704
BseXI	GCAGC	1 cut(s)	446
BsgI	GTGCAG	1 cut(s)	1212
BshVI	ATCGAT	1 cut(s)	472
BsiHKAI	GWGCWC	1 cut(s)	704
BslFI	GGGAC	2 cut(s)	854, 1228
BslI	CCNNNNNNNGG	2 cut(s)	49, 763
BsmAI	GTCTC	3 cut(s)	68, 588, 908
BsmFI	GGGAC	2 cut(s)	854, 1228
Bso31I	GGTCTC	2 cut(s)	68, 908
Bsp1286I	GDGCHC	1 cut(s)	704
Bsp143I	GATC	4 cut(s)	193, 1117, 1168, 1327
Bsp1720I	GCTNAGC	1 cut(s)	1053
BspACI	CCGC	2 cut(s)	174, 924
BspCNI	CTCAG	4 cut(s)	1020, 1045, 1066, 1321
BspDI	ATCGAT	1 cut(s)	472
BspPI	GGATC	2 cut(s)	201, 1163
BspTNI	GGTCTC	2 cut(s)	68, 908
BsrDI	GCAATG	2 cut(s)	242, 1372
BsrI	ACTGG	4 cut(s)	323, 797, 1098, 1241
BssECI	CCNNGG	1 cut(s)	1172
BssMI	GATC	4 cut(s)	193, 1117, 1168, 1327
Bst2UI	CCWGG	3 cut(s)	161, 672, 1173
Bst4CI	ACNGT	4 cut(s)	11, 217, 570, 629
Bst6I	CTCTTC	2 cut(s)	194, 516
BstC8I	GCNNGC	3 cut(s)	85, 911, 1350
BstDEI	CTNAG	5 cut(s)	855, 1007, 1032, 1053, 1308
BstF5I	GGATG	3 cut(s)	76, 746, 1094
BstHHI	GCGC	1 cut(s)	915
BstKTI	GATC	4 cut(s)	196, 1120, 1171, 1330
BstMAI	GTCTC	3 cut(s)	68, 588, 908
BstMBI	GATC	4 cut(s)	193, 1117, 1168, 1327
BstMWI	GCNNNNNNNGC	1 cut(s)	52
BstNI	CCWGG	3 cut(s)	161, 672, 1173
BstNSI	RCATGY	2 cut(s)	1228, 1352
BstSCI	CCNGG	3 cut(s)	159, 670, 1171
BstSLI	GKGCMC	1 cut(s)	704
BstV1I	GCAGC	1 cut(s)	446
BstV2I	GAAGAC	1 cut(s)	876
BstX2I	RGATCY	2 cut(s)	1117, 1327
BstYI	RGATCY	2 cut(s)	1117, 1327
Bsu15I	ATCGAT	1 cut(s)	472
BsuTUI	ATCGAT	1 cut(s)	472
BtrI	CACGTC	1 cut(s)	971
BtsCI	GGATG	3 cut(s)	76, 746, 1094
BtsIMutI	CAGTG	5 cut(s)	16, 99, 575, 634, 661
Cac8I	GCNNGC	3 cut(s)	85, 911, 1350
CfoI	GCGC	1 cut(s)	915
ClaI	ATCGAT	1 cut(s)	472
Csp6I	GTAC	6 cut(s)	28, 177, 267, 337, 862, 1317
CviAII	CATG	8 cut(s)	31, 67, 484, 501, 515, 1133, 1225, 1349
CviQI	GTAC	6 cut(s)	28, 177, 267, 337, 862, 1317
DdeI	CTNAG	5 cut(s)	855, 1007, 1032, 1053, 1308
DpnI	GATC	4 cut(s)	195, 1119, 1170, 1329
DpnII	GATC	4 cut(s)	193, 1117, 1168, 1327
DriI	GACNNNNNGTC	1 cut(s)	1128
Eam1104I	CTCTTC	2 cut(s)	194, 516
Eam1105I	GACNNNNNGTC	1 cut(s)	1128
EarI	CTCTTC	2 cut(s)	194, 516
Eco31I	GGTCTC	2 cut(s)	68, 908
Eco57I	CTGAAG	1 cut(s)	983
EcoRII	CCWGG	3 cut(s)	159, 670, 1171
EcoT22I	ATGCAT	1 cut(s)	420
FaeI	CATG	8 cut(s)	34, 70, 487, 504, 518, 1136, 1228, 1352
FaqI	GGGAC	2 cut(s)	854, 1228
FatI	CATG	8 cut(s)	30, 66, 483, 500, 514, 1132, 1224, 1348
FauNDI	CATATG	1 cut(s)	1210
Fnu4HI	GCNGC	2 cut(s)	460, 924
FokI	GGATG	3 cut(s)	83, 753, 1081
Fsp4HI	GCNGC	2 cut(s)	460, 924
FspBI	CTAG	3 cut(s)	180, 735, 965
GlaI	GCGC	1 cut(s)	914
GluI	GCNGC	2 cut(s)	460, 924
HhaI	GCGC	1 cut(s)	915
Hin1II	CATG	8 cut(s)	34, 70, 487, 504, 518, 1136, 1228, 1352
Hin6I	GCGC	1 cut(s)	913
HinP1I	GCGC	1 cut(s)	913
HindIII	AAGCTT	1 cut(s)	1257
HinfI	GANTC	4 cut(s)	248, 505, 991, 1024
Hpy166II	GTNNAC	2 cut(s)	481, 702
Hpy188I	TCNGA	6 cut(s)	198, 442, 466, 1035, 1086, 1122
Hpy188III	TCNNGA	2 cut(s)	401, 707
Hpy8I	GTNNAC	2 cut(s)	481, 702
HpyAV	CCTTC	3 cut(s)	307, 597, 893
HpyCH4III	ACNGT	4 cut(s)	11, 217, 570, 629
HpyCH4IV	ACGT	2 cut(s)	970, 1287
HpyF10VI	GCNNNNNNNGC	1 cut(s)	52
HpyF3I	CTNAG	5 cut(s)	855, 1007, 1032, 1053, 1308
HpySE526I	ACGT	2 cut(s)	970, 1287
Hsp92II	CATG	8 cut(s)	34, 70, 487, 504, 518, 1136, 1228, 1352
HspAI	GCGC	1 cut(s)	913
Kzo9I	GATC	4 cut(s)	193, 1117, 1168, 1327
LmnI	GCTCC	4 cut(s)	277, 291, 488, 1112
Lsp1109I	GCAGC	1 cut(s)	446
LweI	GCATC	1 cut(s)	1103
MaeI	CTAG	3 cut(s)	180, 735, 965
MaeII	ACGT	2 cut(s)	970, 1287
MaeIII	GTNAC	2 cut(s)	5, 97
MalI	GATC	4 cut(s)	195, 1119, 1170, 1329
MboI	GATC	4 cut(s)	193, 1117, 1168, 1327
MboII	GAAGA	8 cut(s)	49, 113, 211, 503, 779, 803, 881, 1027
MflI	RGATCY	2 cut(s)	1117, 1327
MhlI	GDGCHC	1 cut(s)	704
MlyI	GAGTC	1 cut(s)	499
MmeI	TCCRAC	1 cut(s)	199
MnlI	CCTC	5 cut(s)	18, 72, 519, 831, 844
Mph1103I	ATGCAT	1 cut(s)	420
MseI	TTAA	6 cut(s)	390, 876, 956, 1152, 1163, 1182
MslI	CAYNNNNRTG	1 cut(s)	519
MspR9I	CCNGG	3 cut(s)	161, 672, 1173
MvaI	CCWGG	3 cut(s)	161, 672, 1173
MwoI	GCNNNNNNNGC	1 cut(s)	52
NdeI	CATATG	1 cut(s)	1210
NdeII	GATC	4 cut(s)	193, 1117, 1168, 1327
NlaIII	CATG	8 cut(s)	34, 70, 487, 504, 518, 1136, 1228, 1352
NmuCI	GTSAC	1 cut(s)	97
NsiI	ATGCAT	1 cut(s)	420
NspI	RCATGY	2 cut(s)	1228, 1352
PaeI	GCATGC	1 cut(s)	1352
PfeI	GAWTC	3 cut(s)	248, 991, 1024
PflMI	CCANNNNNTGG	2 cut(s)	49, 763
PkrI	GCNGC	2 cut(s)	461, 925
PleI	GAGTC	1 cut(s)	499
PpsI	GAGTC	1 cut(s)	499
Psp6I	CCWGG	3 cut(s)	159, 670, 1171
PspGI	CCWGG	3 cut(s)	159, 670, 1171
PsuI	RGATCY	2 cut(s)	1117, 1327
RsaI	GTAC	6 cut(s)	29, 178, 268, 338, 863, 1318
RsaNI	GTAC	6 cut(s)	28, 177, 267, 337, 862, 1317
RseI	CAYNNNNRTG	1 cut(s)	519
SaqAI	TTAA	6 cut(s)	390, 876, 956, 1152, 1163, 1182
SatI	GCNGC	2 cut(s)	460, 924
Sau3AI	GATC	4 cut(s)	193, 1117, 1168, 1327
SchI	GAGTC	1 cut(s)	499
ScrFI	CCNGG	3 cut(s)	161, 672, 1173
SduI	GDGCHC	1 cut(s)	704
SfaNI	GCATC	1 cut(s)	1103
SmiMI	CAYNNNNRTG	1 cut(s)	519
SmlI	CTYRAG	1 cut(s)	705
SmoI	CTYRAG	1 cut(s)	705
SphI	GCATGC	1 cut(s)	1352
SsiI	CCGC	2 cut(s)	174, 924
SspMI	CTAG	3 cut(s)	180, 735, 965
StyD4I	CCNGG	3 cut(s)	159, 670, 1171
TaaI	ACNGT	4 cut(s)	11, 217, 570, 629
TaiI	ACGT	2 cut(s)	973, 1290
TaqI	TCGA	1 cut(s)	472
TatI	WGTACW	3 cut(s)	266, 861, 1316
TauI	GCSGC	1 cut(s)	926
TfiI	GAWTC	3 cut(s)	248, 991, 1024
Tru1I	TTAA	6 cut(s)	390, 876, 956, 1152, 1163, 1182
Tru9I	TTAA	6 cut(s)	390, 876, 956, 1152, 1163, 1182
TscAI	CASTG	5 cut(s)	16, 106, 575, 634, 661
TseFI	GTSAC	1 cut(s)	97
TseI	GCWGC	1 cut(s)	459
Tsp45I	GTSAC	1 cut(s)	97
TspDTI	ATGAA	4 cut(s)	503, 635, 1168, 1289
TspGWI	ACGGA	1 cut(s)	206
TspRI	CASTG	5 cut(s)	16, 106, 575, 634, 661
Van91I	CCANNNNNTGG	2 cut(s)	49, 763
VneI	GTGCAC	1 cut(s)	700
XapI	RAATTY	4 cut(s)	224, 665, 1036, 1240
XceI	RCATGY	2 cut(s)	1228, 1352
XspI	CTAG	3 cut(s)	180, 735, 965
Zsp2I	ATGCAT	1 cut(s)	420

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.