Rmu_ssc0000119.1_g000026

Zein-binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000119.1
OG0011994
Physical Location & Seq
Forward (+)
103188 .. 108274
5087 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000119.1_g000026.1.cds

Sequence Viewer

Length: 4419 bp
atgggagagctctcacgcttcatggtctatgctgtgcttgaatgggccttgatcattctgctcttcattgatggcctttttgcttttgttgccaatgaattcgccaagctatttgagctcagatacccctgctggctttgctccaggatcgatcacattctcgttaacagaggtcgtgatttctattataatgattccatatgtgaatcacacaagaaagatgtctcataccttgcttactgccacaaccacaagaggctatccgacataagaaagatgtgtgaggcatgtcttctttcatttgcaaccgaaaaagagtctgatttcgacacatacaagtccctagttgggatcttgcacaaggatctcgagtgctttgtggaggatgatgaacatcaaattcagttgagtgtgcctgcagcaaggacatgggaggacgcagggtcgattgagaagagtagggacagcatgaccatagggtgttcatgttgcggggcgccattgaagttgagttcagcttcctcctactcaaaagcaaagggtgttagcgggctagcgcaagctcctacgccttctccacgagcacccgcagggagaaatgatgataatcctggtttggacttgccccctattcgatatccagaactcaagtttatgtctgataatgagtctgagcttccagaggatgtgtatggaacacacatgaaaaatcaaaaggaagatccgaaagctgctacattgccattattgacagaaggtgatgagttagctgatgatgctaacaggactcctatatatggcagaggaaacaggttctttggaatcccactttcagattcagctcaaaatagtcctagggtggctatgaggatttcaaagaaatcaccactcgaaaagagcgagtttgctttggaatcggttgatggaaatcttccaaatgatgcagattgtgattcaattttgcaccgtctgaagagacaggtccgcttggacaggaagtcactgatggctttgtacatggaactcgatgaagaaagaagtgcttcagctgtagcagccaacaatgcaatggctatgatcacaaggctacaagcagagaaggctgctgttcagatggaggcattgcaatatcagagaatgatggaggagcaggcggagtatgaccaagaagccctggaagcaacatatgatttgcttgccaagagagaagatgatctcagggttttagaggctgaaatagaggcttatagggagaaatatggattgttgaaggaatttgtctacaaggaccaagatgaggctggtgaatgtggtactcctctgagcgtaaagtatggcgcaaacaacatgcaaaatgatcaagccgggtcagcaaaggaagagaatgcagaggctgcccacggcgaaaatttgaaaccactgaaaggggagaagacttacctacttgggcggttcaagaaactagacaagatgagaaactcatcatctaatgggttcttgccagatggtctgaatgaggatgagataggaaatggaaacaaagctgccctaacaaggcaattgtcgctgttgtctcatcttagtgatagagtgaaggctcttgaatctgacaccggattcctagagtatgctgctaagacacttgagaaacatagtgaaggaacaaaacttttgacagagataactcaaaatttacagaagctccggcacctagtgaatctgcctactgaggagcaaaacaagacgcctccggtggaacaaaagaaggagcaaaacaagacggattcggaggaacaaaagaaggagcaaaacaagacgcttccggaggaacaaaataagacgtctccttctcatcagcctctgagtactctcatttttcgactccatattcataacaaccttcaaatttccaatctaaagccaccaaaagttcttgagctctcacgcttcatggtctatgctgtgcttgaatgggccttgatcattctgctcttcattgatggcctttttgcttttgttgccaatgaattcgccaagctatttgagctcagatacccctgctggctttgctccaggatcgatcacattctcgttaacagaggtcgtgatttctattataatgattccatatgtgaatcacacaagaaagatgtctcataccttgcttactgccacaaccacaagaggctatccgacataagaaagatgtgtgaggcatgtcttctttcatttgcaaccgaaaaagagtctgatttcgacacatacaagtccctagttgggatcttgcacaaggatctcgagtgctttgtggaggatgatgaacatcaaattcagttgagtgtgcctgcagcaaggacatgggaggatgcagggtcgattgagaagagtagggacagcatgaccatagggtgttcatgttgcggggcgccattgaagttgagttcagcttcctcctactcaaaagcaaagggtgttagcgggctagcgcaagctcctacgccttctccacgagcacccgcagggagaaatgatgataatcctggtttggacttgccccctattcgatatccagaactcaagtttatgtctgataatgagtctgagcttccagaggatgtgtatggaacacacatgaaaaatcaaaaggaagatccgaaagctgctacattgccattattgacagaaggtgatgagttagctgatgatgctaacaggactcctatatatggcagaggaaacaggttctttggaatcccactttcagattcagctcaaaatagtcctagggtggctatgaggatttcaaagaaatcaccactcgaaaagagcgagtttgctttggaatcggttgatggaaatcttccaaatgatgcagattgtgattcaattttgcaccgtctgaagagacaggtccgcttggacaggaagtcactgatggctttgtacatggaactcgatgaagaaagaagtgcttcagctgtagcagccaacaatgcaatggctatgatcacaaggctacaagcagagaaggctgctgttcagatggaggcattgcaatatcagagaatgatggaggagcaggcggagtatgaccaagaagccctggaagcaacatatgatttgcttgccaagagagaagatgatctcagggttttagaggctgaaatagaggcttatagggagaaatatggattgttgaaggaatttgtctacaaggaccaagatgaggctggtgaatgtggtactcctctgagcgtaaagtatggcgcaaacaacatgcaaaatgatcaagccgggtcagcaaaggaagagaatgcagaggctgcccacggcgaaaatttgaaaccactgaaaggggagaagacttacctacttgggcggttcaagaaactagacaagatgagaaactcatcatctaatgggttcttgccagatggtctgaatgaggatgagataggaaatggaaacaaagctgccctaacaaggcaattgtcgctgttgtctcatcttagtgatagagtgaaggctcttgaatctgacaccggattcctagagtatgctgctaagacacttgagaaacatagtgaaggaacaaaacttttgacagagataactcaaaatttacagaagctccggcacctagtgaatctgcctactgaggagcaaaacaagacgcctccggtggaacaaaagaaggagcaaaacaagacggattcggaggaacaaaagaaggagcaaaacaagacgcttccggaggaacaaaataagacgtctccggaggaacaaaaggagcaaagtaagacgccttcggaggaacaaaaggagcaaaacaagacgcctccaggggaacaaaagaaggagcaaaacaagacgcctccggaggaacaaaataaggcgcatccggaggaacaaaaggagcaaagagtggaggaacaaaaggagcaaagtaagacgccttcggaggaacaaaaggagcaaaacaagacgcctccggaggaacaaaataaggcgcatctggaggaacaaaaggagcaaagtaagatgccttcggaggaacaaaaggagcaaaacaagaagcttccggaggatcaaaaggagcaaaacaagacacctccagaggaacaaaagaaggagcaaagtaggacgcctccagaggaacaaaaggagcaaagtaagacgcctccacaagaacaaaagaatgagcaaagtaagacgccatccgaagaacaaaataaggagcaaaacaatatgcccccggaggaacaaagtaagacgcctccagaggaacaaaacgagcaaaagaagacgctttcagatgaacaaaataagattcctccggaagaacaaaacaaaatgtctccagaagaacagaaaaaggaacaaaaagaccttacttctatagtaaaaagttggttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Zein-binding

Protein Analysis

1472

Amino Acids

167.05

Weight (kDa)

5.16

Isoelectric Point (pI)

59.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011994)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G18990 AT1G74830
fragaria_vesca FvH4_5g16010
malus_domestica MD06G1183700.v1.1 MD14G1189800.v1.1
prunus_persica Prupe.5G182400_v2.0.a1
pyrus_communis pycom14g15730 pycom14g15740
rosa_chinensis RchiOBHm_Chr7g0180061
rosa_laevigata RLG00000005298
rosa_multiflora Rmu_sc0002219.1_g000024 Rmu_ssc0000119.1_g000026
rosa_roxburghii Rroxscaffold_3G00273160
rosa_rugosa Rorug06G0430200
rosa_samantha Rh7AG030500 Rh7BG030400 Rh7CG032200 Rh7DG031200
rosa_wichuraiana Rw7G002540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 189, 2118
AatII GACGTC 2 cut(s) 1844, 3773
AccB1I GGYRCC 4 cut(s) 496, 1707, 2425, 3636
AccI GTMKAC 2 cut(s) 1281, 3210
AccIII TCCGGA 8 cut(s) 1822, 3751, 3775, 3877, 3901, 3991, 4081, 4336
AclWI GGATC 9 cut(s) 155, 359, 372, 716, 2084, 2288, 2301, 2645, 4095
AcuI CTGAAG 4 cut(s) 992, 1029, 2921, 2958
AdeI CACNNNGTG 2 cut(s) 1714, 3643
AfaI GTAC 5 cut(s) 1016, 1315, 1867, 2945, 3244
AhdI GACNNNNNGTC 3 cut(s) 442, 997, 2926
AjnI CCWGG 7 cut(s) 143, 610, 1173, 2072, 2539, 3102, 3841
Alw21I GWGCWC 6 cut(s) 12, 120, 586, 1941, 2049, 2515
Alw26I GTCTC 9 cut(s) 229, 970, 1578, 1848, 2158, 2899, 3507, 3777, 4362
AlwI GGATC 9 cut(s) 155, 359, 372, 716, 2084, 2288, 2301, 2645, 4095
AlwNI CAGNNNCTG 3 cut(s) 1394, 1861, 3323
Ama87I CYCGRG 2 cut(s) 368, 2297
Aor13HI TCCGGA 8 cut(s) 1822, 3751, 3775, 3877, 3901, 3991, 4081, 4336
AoxI GGCC 4 cut(s) 45, 73, 1974, 2002
Asp700I GAANNNNTTC 2 cut(s) 1042, 2971
AspA2I CCTAGG 2 cut(s) 854, 2783
AspLEI GCGC 8 cut(s) 499, 559, 1340, 2428, 2488, 3269, 3898, 4012
AspS9I GGNCC 6 cut(s) 45, 982, 1288, 1974, 2911, 3217
AsuC2I CCSGG 3 cut(s) 1366, 3295, 4256
AsuHPI GGTGA 6 cut(s) 770, 876, 1316, 2699, 2805, 3245
AsuNHI GCTAGC 2 cut(s) 553, 2482
AvaI CYCGRG 2 cut(s) 368, 2297
AvaII GGWCC 4 cut(s) 982, 1288, 2911, 3217
AvrII CCTAGG 2 cut(s) 854, 2783
BanI GGYRCC 4 cut(s) 496, 1707, 2425, 3636
BanII GRGCYC 4 cut(s) 12, 120, 1941, 2049
BarI GAAGNNNNNNTAC 6 cut(s) 3790, 3822, 3940, 3972, 4030, 4062
BauI CACGAG 2 cut(s) 579, 2508
BbsI GAAGAC 5 cut(s) 284, 1439, 2213, 3368, 4310
Bbv12I GWGCWC 6 cut(s) 12, 120, 586, 1941, 2049, 2515
BceAI ACGGC 2 cut(s) 1417, 3346
BciT130I CCWGG 7 cut(s) 145, 612, 1175, 2074, 2541, 3104, 3843
BclI TGATCA 6 cut(s) 51, 1077, 1357, 1980, 3006, 3286
BcnI CCSGG 3 cut(s) 1366, 3295, 4256
BcoDI GTCTC 9 cut(s) 229, 970, 1578, 1848, 2158, 2899, 3507, 3777, 4362
BfmI CTRYAG 5 cut(s) 417, 1050, 2346, 2979, 4398
BfoI RGCGCY 2 cut(s) 500, 2429
BlnI CCTAGG 2 cut(s) 854, 2783
BmcAI AGTACT 1 cut(s) 1867
Bme18I GGWCC 4 cut(s) 982, 1288, 2911, 3217
BmeRI GACNNNNNGTC 3 cut(s) 442, 997, 2926
BmeT110I CYCGRG 2 cut(s) 368, 2297
BmgT120I GGNCC 6 cut(s) 45, 982, 1288, 1974, 2911, 3217
BmiI GGNNCC 4 cut(s) 498, 1709, 2427, 3638
BmsI GCATC 8 cut(s) 766, 931, 2356, 2695, 2860, 3907, 4021, 4032
BmtI GCTAGC 2 cut(s) 557, 2486
BpiI GAAGAC 5 cut(s) 284, 1439, 2213, 3368, 4310
BpmI CTGGAG 8 cut(s) 127, 2056, 3825, 4037, 4098, 4134, 4263, 4344
BpuEI CTTGAG 5 cut(s) 632, 1664, 1955, 2561, 3593
BpuMI CCSGG 3 cut(s) 1366, 3295, 4256
Bsa29I ATCGAT 2 cut(s) 150, 2079
BsaBI GATNNNNATC 6 cut(s) 393, 606, 927, 2322, 2535, 2856
BsaJI CCNNGG 8 cut(s) 854, 1173, 1399, 2783, 3102, 3328, 3842, 4254
BsaXI ACNNNNNCTCC 8 cut(s) 559, 589, 1686, 1716, 2488, 2518, 3615, 3645
Bse3DI GCAATG 6 cut(s) 737, 1074, 1121, 2666, 3003, 3050
Bse8I GATNNNNATC 6 cut(s) 393, 606, 927, 2322, 2535, 2856
BseAI TCCGGA 8 cut(s) 1822, 3751, 3775, 3877, 3901, 3991, 4081, 4336
BseBI CCWGG 7 cut(s) 145, 612, 1175, 2074, 2541, 3104, 3843
BseCI ATCGAT 2 cut(s) 150, 2079
BseDI CCNNGG 8 cut(s) 854, 1173, 1399, 2783, 3102, 3328, 3842, 4254
BseGI GGATG 9 cut(s) 391, 691, 1525, 2320, 2371, 2620, 3454, 3898, 4217
BseJI GATNNNNATC 6 cut(s) 393, 606, 927, 2322, 2535, 2856
BseMI GCAATG 6 cut(s) 737, 1074, 1121, 2666, 3003, 3050
BseRI GAGGAG 6 cut(s) 1160, 1308, 1745, 3089, 3237, 3674
BshFI GGCC 4 cut(s) 47, 75, 1976, 2004
BshNI GGYRCC 4 cut(s) 496, 1707, 2425, 3636
BshVI ATCGAT 2 cut(s) 150, 2079
BsiHKAI GWGCWC 6 cut(s) 12, 120, 586, 1941, 2049, 2515
BsiHKCI CYCGRG 2 cut(s) 368, 2297
BslFI GGGAC 4 cut(s) 325, 476, 2254, 2405
BsmAI GTCTC 9 cut(s) 229, 970, 1578, 1848, 2158, 2899, 3507, 3777, 4362
BsmBI CGTCTC 2 cut(s) 1848, 3777
BsmFI GGGAC 4 cut(s) 325, 476, 2254, 2405
BsmI GAATGC 2 cut(s) 1390, 3319
BsnI GGCC 4 cut(s) 47, 75, 1976, 2004
BsoBI CYCGRG 2 cut(s) 368, 2297
Bsp1286I GDGCHC 6 cut(s) 12, 120, 586, 1941, 2049, 2515
Bsp13I TCCGGA 8 cut(s) 1822, 3751, 3775, 3877, 3901, 3991, 4081, 4336
Bsp1407I TGTACA 2 cut(s) 1014, 2943
BspANI GGCC 4 cut(s) 47, 75, 1976, 2004
BspDI ATCGAT 2 cut(s) 150, 2079
BspEI TCCGGA 8 cut(s) 1822, 3751, 3775, 3877, 3901, 3991, 4081, 4336
BspLI GGNNCC 4 cut(s) 498, 1709, 2427, 3638
BspMAI CTGCAG 2 cut(s) 421, 2350
BspOI GCTAGC 2 cut(s) 557, 2486
BspPI GGATC 9 cut(s) 155, 359, 372, 716, 2084, 2288, 2301, 2645, 4095
BspQI GCTCTTC 2 cut(s) 68, 1997
BspT107I GGYRCC 4 cut(s) 496, 1707, 2425, 3636
BsrDI GCAATG 6 cut(s) 737, 1074, 1121, 2666, 3003, 3050
BsrGI TGTACA 2 cut(s) 1014, 2943
BssECI CCNNGG 8 cut(s) 854, 1173, 1399, 2783, 3102, 3328, 3842, 4254
BssSI CACGAG 2 cut(s) 579, 2508
BssT1I CCWWGG 2 cut(s) 854, 2783
Bst2BI CACGAG 2 cut(s) 579, 2508
Bst2UI CCWGG 7 cut(s) 145, 612, 1175, 2074, 2541, 3104, 3843
Bst4CI ACNGT 2 cut(s) 968, 2897
Bst6I CTCTTC 8 cut(s) 68, 449, 968, 1374, 1997, 2378, 2897, 3303
BstAPI GCANNNNNTGC 2 cut(s) 1394, 3323
BstAUI TGTACA 2 cut(s) 1014, 2943
BstDSI CCRYGG 2 cut(s) 1399, 3328
BstF5I GGATG 9 cut(s) 391, 691, 1525, 2320, 2371, 2620, 3454, 3898, 4217
BstH2I RGCGCY 2 cut(s) 500, 2429
BstHHI GCGC 8 cut(s) 499, 559, 1340, 2428, 2488, 3269, 3898, 4012
BstMAI GTCTC 9 cut(s) 229, 970, 1578, 1848, 2158, 2899, 3507, 3777, 4362
BstNI CCWGG 7 cut(s) 145, 612, 1175, 2074, 2541, 3104, 3843
BstNSI RCATGY 4 cut(s) 291, 1351, 2220, 3280
BstSFI CTRYAG 5 cut(s) 417, 1050, 2346, 2979, 4398
BstV2I GAAGAC 5 cut(s) 284, 1439, 2213, 3368, 4310
BstX2I RGATCY 6 cut(s) 351, 364, 721, 2280, 2293, 2650
BstYI RGATCY 6 cut(s) 351, 364, 721, 2280, 2293, 2650
Bsu15I ATCGAT 2 cut(s) 150, 2079
BsuRI GGCC 4 cut(s) 47, 75, 1976, 2004
BsuTUI ATCGAT 2 cut(s) 150, 2079
BtgI CCRYGG 2 cut(s) 1399, 3328
BtsCI GGATG 9 cut(s) 391, 691, 1525, 2320, 2371, 2620, 3454, 3898, 4217
BtsIMutI CAGTG 4 cut(s) 1001, 1418, 2930, 3347
CaiI CAGNNNCTG 3 cut(s) 1394, 1861, 3323
CfoI GCGC 8 cut(s) 499, 559, 1340, 2428, 2488, 3269, 3898, 4012
Cfr13I GGNCC 6 cut(s) 45, 982, 1288, 1974, 2911, 3217
ClaI ATCGAT 2 cut(s) 150, 2079
Csp6I GTAC 5 cut(s) 1015, 1314, 1866, 2944, 3243
CviQI GTAC 5 cut(s) 1015, 1314, 1866, 2944, 3243
DinI GGCGCC 2 cut(s) 498, 2427
DraIII CACNNNGTG 2 cut(s) 1714, 3643
DriI GACNNNNNGTC 3 cut(s) 442, 997, 2926
Eam1104I CTCTTC 8 cut(s) 68, 449, 968, 1374, 1997, 2378, 2897, 3303
Eam1105I GACNNNNNGTC 3 cut(s) 442, 997, 2926
EarI CTCTTC 8 cut(s) 68, 449, 968, 1374, 1997, 2378, 2897, 3303
EciI GGCGGA 2 cut(s) 1169, 3098
Ecl136II GAGCTC 4 cut(s) 10, 118, 1939, 2047
Eco130I CCWWGG 2 cut(s) 854, 2783
Eco24I GRGCYC 4 cut(s) 12, 120, 1941, 2049
Eco32I GATATC 2 cut(s) 638, 2567
Eco47I GGWCC 4 cut(s) 982, 1288, 2911, 3217
Eco53kI GAGCTC 4 cut(s) 10, 118, 1939, 2047
Eco57I CTGAAG 4 cut(s) 992, 1029, 2921, 2958
Eco88I CYCGRG 2 cut(s) 368, 2297
EcoICRI GAGCTC 4 cut(s) 10, 118, 1939, 2047
EcoRI GAATTC 2 cut(s) 98, 2027
EcoRII CCWGG 7 cut(s) 143, 610, 1173, 2072, 2539, 3102, 3841
EcoRV GATATC 2 cut(s) 638, 2567
EcoT14I CCWWGG 2 cut(s) 854, 2783
EcoT38I GRGCYC 4 cut(s) 12, 120, 1941, 2049
EgeI GGCGCC 2 cut(s) 498, 2427
EheI GGCGCC 2 cut(s) 498, 2427
ErhI CCWWGG 2 cut(s) 854, 2783
Esp3I CGTCTC 2 cut(s) 1848, 3777
FalI AAGNNNNNCTT 4 cut(s) 1027, 1059, 2956, 2988
FaqI GGGAC 4 cut(s) 325, 476, 2254, 2405
FauI CCCGC 6 cut(s) 485, 542, 595, 2414, 2471, 2524
FauNDI CATATG 4 cut(s) 200, 1186, 2129, 3115
FbaI TGATCA 6 cut(s) 51, 1077, 1357, 1980, 3006, 3286
FblI GTMKAC 2 cut(s) 1281, 3210
FokI GGATG 9 cut(s) 398, 698, 1532, 2327, 2378, 2627, 3461, 3885, 4204
FriOI GRGCYC 4 cut(s) 12, 120, 1941, 2049
GlaI GCGC 8 cut(s) 498, 558, 1339, 2427, 2487, 3268, 3897, 4011
GsuI CTGGAG 8 cut(s) 127, 2056, 3825, 4037, 4098, 4134, 4263, 4344
HaeII RGCGCY 2 cut(s) 500, 2429
HaeIII GGCC 4 cut(s) 47, 75, 1976, 2004
HhaI GCGC 8 cut(s) 499, 559, 1340, 2428, 2488, 3269, 3898, 4012
Hin6I GCGC 8 cut(s) 497, 557, 1338, 2426, 2486, 3267, 3896, 4010
HinP1I GCGC 8 cut(s) 497, 557, 1338, 2426, 2486, 3267, 3896, 4010
HincII GTYRAC 2 cut(s) 166, 2095
HindII GTYRAC 2 cut(s) 166, 2095
HindIII AAGCTT 1 cut(s) 4076
HpaI GTTAAC 2 cut(s) 166, 2095
HphI GGTGA 6 cut(s) 770, 876, 1316, 2699, 2805, 3245
Hpy166II GTNNAC 4 cut(s) 166, 1282, 2095, 3211
Hpy8I GTNNAC 4 cut(s) 166, 1282, 2095, 3211
HpyCH4III ACNGT 2 cut(s) 968, 2897
HpyCH4IV ACGT 2 cut(s) 1841, 3770
HpySE526I ACGT 2 cut(s) 1841, 3770
HspAI GCGC 8 cut(s) 497, 557, 1338, 2426, 2486, 3267, 3896, 4010
KasI GGCGCC 2 cut(s) 496, 2425
Kpn2I TCCGGA 8 cut(s) 1822, 3751, 3775, 3877, 3901, 3991, 4081, 4336
Ksp22I TGATCA 6 cut(s) 51, 1077, 1357, 1980, 3006, 3286
KspAI GTTAAC 2 cut(s) 166, 2095
LguI GCTCTTC 2 cut(s) 68, 1997
LweI GCATC 8 cut(s) 766, 931, 2356, 2695, 2860, 3907, 4021, 4032
MaeII ACGT 2 cut(s) 1841, 3770
MaeIII GTNAC 2 cut(s) 999, 2928
MfeI CAATTG 2 cut(s) 1559, 3488
MflI RGATCY 6 cut(s) 351, 364, 721, 2280, 2293, 2650
MhlI GDGCHC 6 cut(s) 12, 120, 586, 1941, 2049, 2515
Mly113I GGCGCC 2 cut(s) 497, 2426
MlyI GAGTC 7 cut(s) 326, 677, 781, 1875, 2255, 2606, 2710
MmeI TCCRAC 2 cut(s) 288, 2217
MroI TCCGGA 8 cut(s) 1822, 3751, 3775, 3877, 3901, 3991, 4081, 4336
MroXI GAANNNNTTC 2 cut(s) 1042, 2971
MseI TTAA 2 cut(s) 165, 2094
MslI CAYNNNNRTG 2 cut(s) 1581, 3510
MspA1I CMGCKG 2 cut(s) 1049, 2978
MunI CAATTG 2 cut(s) 1559, 3488
Mva1269I GAATGC 2 cut(s) 1390, 3319
MvaI CCWGG 7 cut(s) 145, 612, 1175, 2074, 2541, 3104, 3843
NarI GGCGCC 2 cut(s) 497, 2426
NciI CCSGG 3 cut(s) 1366, 3295, 4256
NdeI CATATG 4 cut(s) 200, 1186, 2129, 3115
NheI GCTAGC 2 cut(s) 553, 2482
NlaIV GGNNCC 4 cut(s) 498, 1709, 2427, 3638
NmuCI GTSAC 2 cut(s) 999, 2928
NspI RCATGY 4 cut(s) 291, 1351, 2220, 3280
PaeR7I CTCGAG 2 cut(s) 368, 2297
PciSI GCTCTTC 2 cut(s) 68, 1997
PcsI WCGNNNNNNNCGW 2 cut(s) 897, 2826
PctI GAATGC 2 cut(s) 1390, 3319
PdmI GAANNNNTTC 2 cut(s) 1042, 2971
PfoI TCCNGGA 2 cut(s) 143, 2072
PleI GAGTC 7 cut(s) 325, 676, 781, 1875, 2254, 2605, 2710
PluTI GGCGCC 2 cut(s) 500, 2429
PpsI GAGTC 7 cut(s) 325, 676, 781, 1875, 2254, 2605, 2710
PsiI TTATAA 2 cut(s) 189, 2118
Psp124BI GAGCTC 4 cut(s) 12, 120, 1941, 2049
Psp6I CCWGG 7 cut(s) 143, 610, 1173, 2072, 2539, 3102, 3841
PspGI CCWGG 7 cut(s) 143, 610, 1173, 2072, 2539, 3102, 3841
PspN4I GGNNCC 4 cut(s) 498, 1709, 2427, 3638
PspPI GGNCC 6 cut(s) 45, 982, 1288, 1974, 2911, 3217
PstI CTGCAG 2 cut(s) 421, 2350
PstNI CAGNNNCTG 3 cut(s) 1394, 1861, 3323
PsuI RGATCY 6 cut(s) 351, 364, 721, 2280, 2293, 2650
PvuII CAGCTG 2 cut(s) 1049, 2978
RsaI GTAC 5 cut(s) 1016, 1315, 1867, 2945, 3244
RsaNI GTAC 5 cut(s) 1015, 1314, 1866, 2944, 3243
RseI CAYNNNNRTG 2 cut(s) 1581, 3510
SacI GAGCTC 4 cut(s) 12, 120, 1941, 2049
SapI GCTCTTC 2 cut(s) 68, 1997
SaqAI TTAA 2 cut(s) 165, 2094
Sau96I GGNCC 6 cut(s) 45, 982, 1288, 1974, 2911, 3217
ScaI AGTACT 1 cut(s) 1867
SchI GAGTC 7 cut(s) 326, 677, 781, 1875, 2255, 2606, 2710
SduI GDGCHC 6 cut(s) 12, 120, 586, 1941, 2049, 2515
SfaNI GCATC 8 cut(s) 766, 931, 2356, 2695, 2860, 3907, 4021, 4032
SfcI CTRYAG 5 cut(s) 417, 1050, 2346, 2979, 4398
SfoI GGCGCC 2 cut(s) 498, 2427
Sfr274I CTCGAG 2 cut(s) 368, 2297
SinI GGWCC 4 cut(s) 982, 1288, 2911, 3217
SlaI CTCGAG 2 cut(s) 368, 2297
SmiMI CAYNNNNRTG 2 cut(s) 1581, 3510
SmlI CTYRAG 7 cut(s) 368, 647, 1643, 1934, 2297, 2576, 3572
SmoI CTYRAG 7 cut(s) 368, 647, 1643, 1934, 2297, 2576, 3572
SspDI GGCGCC 2 cut(s) 496, 2425
SstI GAGCTC 4 cut(s) 12, 120, 1941, 2049
StyI CCWWGG 2 cut(s) 854, 2783
TaaI ACNGT 2 cut(s) 968, 2897
TaiI ACGT 2 cut(s) 1844, 3773
TatI WGTACW 3 cut(s) 1014, 1865, 2943
Tru1I TTAA 2 cut(s) 165, 2094
Tru9I TTAA 2 cut(s) 165, 2094
TscAI CASTG 4 cut(s) 1008, 1425, 2937, 3354
TseFI GTSAC 2 cut(s) 999, 2928
Tsp45I GTSAC 2 cut(s) 999, 2928
TspGWI ACGGA 2 cut(s) 1796, 3725
TspRI CASTG 4 cut(s) 1008, 1425, 2937, 3354
VpaK11BI GGWCC 4 cut(s) 982, 1288, 2911, 3217
XceI RCATGY 4 cut(s) 291, 1351, 2220, 3280
XcmI CCANNNNNNNNNTGG 4 cut(s) 1066, 1298, 2995, 3227
XhoI CTCGAG 2 cut(s) 368, 2297
XmaJI CCTAGG 2 cut(s) 854, 2783
XmiI GTMKAC 2 cut(s) 1281, 3210
XmnI GAANNNNTTC 2 cut(s) 1042, 2971
ZraI GACGTC 2 cut(s) 1842, 3771
ZrmI AGTACT 1 cut(s) 1867
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.