Rmu_ssc0000124.1_g000019
NAC Family

inactive purple acid phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000124.1
OG0007460
Physical Location & Seq
Forward (+)
79721 .. 82130
2410 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1164 bp
atgggtcgtttgttcacggcggcggcgttggtggtgttgcttccgatctgggttttggcggcggcggcgaagcaccatgaagagaaacccatgaggctgaggtttgggggtgatgggcagtttaagatactgcaagtggcggacatgcactatgccgatgggaaaacgacgccgtgtgaggatgtgctgccgtcacaggtggcgggttgctctgacttaaatacgacggcgtttgttcagcggatgattcaggctgagaagcccaatttcattgttttcaccggagataacatctttgggtctgatgctacggatgctgctaaatcaatggatgcagcatttgccccagcaattgcgtccaacattccgtgggcagctgttttggggaaccatgatcaggagtcggacctttcgagggaaggggtaatgaagcacatagtcaagtataaaagcaccctggctcaactcaatccttcggatcaagatgttattgatggtttcgggaactataacctggaggtaggtggagttcaggggactggttttgaaaacaaatcggttctcaatctatacttccttgacagtggagattactccacagttccctctatccctggctatggttggatcaaaccctcccagcaattttggttccaacaaacttcagcaaagctaaagaaagcatatatgaaaaagccacaggcgcagaaatcaccggctccagggctcgcatactttcacataccgttaccagaatatgctagttttgactcatcaaacttcacaggagtgaggcaagaaggcattagctctgcctccgtgaactctggcttcttcacaaccctggttgaagcgggcgatgtaaaggcagctttcacaggccatgatcacctcaatgacttctgtgggaagctaactggcataaacctttgttatgctgggggattcggataccatgcatatggccaggcaggatgggataggagagcaagggtggtagcagcaaccttagagaaaacaaatactggaggttggggagcagtcaagtcaatcaaaacatggaaacgcctcgacgatcagcacctcagtactatcaatagtgaggttctctggaccaagagttctgcgggtgcacgtagaaagaaacccattggcggtccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0003993 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0009987 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0042578 GO:0044237
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallophos

Protein Analysis

387

Amino Acids

41.96

Weight (kDa)

8.19

Isoelectric Point (pI)

33.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Metallophos PF00149 41 - 297 2.2e-13 Calcineurin-like phosphoesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 486, 635
AcoI YGGCCR 1 cut(s) 964
AcuI CTGAAG 1 cut(s) 648
AcyI GRCGYC 1 cut(s) 170
AfaI GTAC 1 cut(s) 1090
AfiI CCNNNNNNNGG 5 cut(s) 397, 415, 620, 722, 1154
AgsI TTSAA 2 cut(s) 548, 851
AjnI CCWGG 6 cut(s) 456, 513, 613, 721, 843, 966
AleI CACNNNNGTG 1 cut(s) 788
AloI GAACNNNNNNTCC 2 cut(s) 1105, 1137
AluBI AGCT 5 cut(s) 377, 673, 810, 872, 913
AluI AGCT 5 cut(s) 377, 673, 810, 872, 913
Alw21I GWGCWC 1 cut(s) 1135
Alw44I GTGCAC 1 cut(s) 1131
AlwI GGATC 2 cut(s) 486, 635
AoxI GGCC 2 cut(s) 880, 964
ApaLI GTGCAC 1 cut(s) 1131
ApeKI GCWGC 6 cut(s) 187, 317, 335, 374, 869, 1001
AspLEI GCGC 1 cut(s) 706
AspS9I GGNCC 3 cut(s) 406, 1113, 1157
AsuHPI GGTGA 4 cut(s) 122, 271, 705, 881
AvaII GGWCC 3 cut(s) 406, 1113, 1157
BaeGI GKGCMC 1 cut(s) 1135
BalI TGGCCA 1 cut(s) 966
BanII GRGCYC 1 cut(s) 729
Bbv12I GWGCWC 1 cut(s) 1135
BbvCI CCTCAGC 1 cut(s) 98
BbvI GCAGC 6 cut(s) 174, 304, 347, 386, 881, 1013
BccI CCATC 4 cut(s) 107, 152, 488, 969
BceAI ACGGC 4 cut(s) 33, 157, 175, 243
BciT130I CCWGG 6 cut(s) 458, 515, 615, 723, 845, 968
BciVI GTATCC 1 cut(s) 944
BclI TGATCA 2 cut(s) 394, 886
BfaI CTAG 1 cut(s) 762
BfuI GTATCC 1 cut(s) 944
BmcAI AGTACT 1 cut(s) 1090
Bme1390I CCNGG 6 cut(s) 458, 515, 615, 723, 845, 968
Bme18I GGWCC 3 cut(s) 406, 1113, 1157
BmgT120I GGNCC 3 cut(s) 406, 1113, 1157
BmiI GGNNCC 3 cut(s) 389, 653, 720
BmrFI CCNGG 6 cut(s) 458, 515, 615, 723, 845, 968
BmsI GCATC 3 cut(s) 295, 304, 322
BpmI CTGGAG 3 cut(s) 536, 705, 1047
Bpu10I CCTNAGC 1 cut(s) 98
BsaAI YACGTR 1 cut(s) 1136
BsaHI GRCGYC 1 cut(s) 170
BsaJI CCNNGG 5 cut(s) 368, 456, 613, 722, 843
BsaWI WCCGGW 1 cut(s) 281
Bsc4I CCNNNNNNNGG 5 cut(s) 397, 415, 620, 722, 1154
Bse118I RCCGGY 1 cut(s) 715
Bse1I ACTGG 3 cut(s) 544, 922, 1030
BseBI CCWGG 6 cut(s) 458, 515, 615, 723, 845, 968
BseDI CCNNGG 5 cut(s) 368, 456, 613, 722, 843
BseGI GGATG 5 cut(s) 187, 249, 319, 337, 980
BseLI CCNNNNNNNGG 5 cut(s) 397, 415, 620, 722, 1154
BseMII CTCAG 3 cut(s) 89, 246, 1099
BseNI ACTGG 3 cut(s) 544, 922, 1030
BseSI GKGCMC 1 cut(s) 1135
BseXI GCAGC 6 cut(s) 174, 304, 347, 386, 881, 1013
BseYI CCCAGC 3 cut(s) 346, 639, 938
BshFI GGCC 2 cut(s) 882, 966
BsiHKAI GWGCWC 1 cut(s) 1135
BsiSI CCGG 2 cut(s) 282, 716
BslFI GGGAC 1 cut(s) 550
BslI CCNNNNNNNGG 5 cut(s) 397, 415, 620, 722, 1154
BsmFI GGGAC 1 cut(s) 550
BsnI GGCC 2 cut(s) 882, 966
Bsp1286I GDGCHC 2 cut(s) 729, 1135
Bsp143I GATC 6 cut(s) 45, 394, 478, 627, 886, 1075
BspANI GGCC 2 cut(s) 882, 966
BspCNI CTCAG 3 cut(s) 90, 247, 1098
BspLI GGNNCC 3 cut(s) 389, 653, 720
BspPI GGATC 2 cut(s) 486, 635
BsrFI RCCGGY 1 cut(s) 715
BsrI ACTGG 3 cut(s) 544, 922, 1030
BssAI RCCGGY 1 cut(s) 715
BssECI CCNNGG 5 cut(s) 368, 456, 613, 722, 843
BssMI GATC 6 cut(s) 45, 394, 478, 627, 886, 1075
BssNI GRCGYC 1 cut(s) 170
Bst2UI CCWGG 6 cut(s) 458, 515, 615, 723, 845, 968
Bst4CI ACNGT 3 cut(s) 584, 601, 747
Bst6I CTCTTC 1 cut(s) 75
BstACI GRCGYC 1 cut(s) 170
BstAPI GCANNNNNTGC 1 cut(s) 341
BstBAI YACGTR 1 cut(s) 1136
BstC8I GCNNGC 2 cut(s) 729, 856
BstDEI CTNAG 4 cut(s) 98, 255, 1009, 1085
BstDSI CCRYGG 1 cut(s) 368
BstF5I GGATG 5 cut(s) 187, 249, 319, 337, 980
BstHHI GCGC 1 cut(s) 706
BstKTI GATC 6 cut(s) 48, 397, 481, 630, 889, 1078
BstMBI GATC 6 cut(s) 45, 394, 478, 627, 886, 1075
BstMWI GCNNNNNNNGC 4 cut(s) 65, 314, 341, 703
BstNI CCWGG 6 cut(s) 458, 515, 615, 723, 845, 968
BstNSI RCATGY 1 cut(s) 148
BstSCI CCNGG 6 cut(s) 456, 513, 613, 721, 843, 966
BstSLI GKGCMC 1 cut(s) 1135
BstV1I GCAGC 6 cut(s) 174, 304, 347, 386, 881, 1013
BstXI CCANNNNNNTGG 1 cut(s) 962
BsuI GTATCC 1 cut(s) 944
BsuRI GGCC 2 cut(s) 882, 966
BtgI CCRYGG 1 cut(s) 368
BtgZI GCGATG 1 cut(s) 873
BtsCI GGATG 5 cut(s) 187, 249, 319, 337, 980
BtsIMutI CAGTG 1 cut(s) 589
Cac8I GCNNGC 2 cut(s) 729, 856
CfoI GCGC 1 cut(s) 706
Cfr10I RCCGGY 1 cut(s) 715
Cfr13I GGNCC 3 cut(s) 406, 1113, 1157
CseI GACGC 2 cut(s) 178, 345
Csp6I GTAC 1 cut(s) 1089
CviAII CATG 7 cut(s) 77, 91, 145, 392, 884, 956, 1059
CviQI GTAC 1 cut(s) 1089
DdeI CTNAG 4 cut(s) 98, 255, 1009, 1085
DpnI GATC 6 cut(s) 47, 396, 480, 629, 888, 1077
DpnII GATC 6 cut(s) 45, 394, 478, 627, 886, 1075
EaeI YGGCCR 1 cut(s) 964
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
EciI GGCGGA 1 cut(s) 155
Eco24I GRGCYC 1 cut(s) 729
Eco47I GGWCC 3 cut(s) 406, 1113, 1157
Eco57I CTGAAG 1 cut(s) 648
EcoRII CCWGG 6 cut(s) 456, 513, 613, 721, 843, 966
EcoT22I ATGCAT 1 cut(s) 961
EcoT38I GRGCYC 1 cut(s) 729
FaeI CATG 7 cut(s) 80, 94, 148, 395, 887, 959, 1062
FaqI GGGAC 1 cut(s) 550
FatI CATG 7 cut(s) 76, 90, 144, 391, 883, 955, 1058
FauI CCCGC 3 cut(s) 196, 847, 1120
FauNDI CATATG 1 cut(s) 961
FbaI TGATCA 2 cut(s) 394, 886
FokI GGATG 5 cut(s) 194, 256, 326, 344, 987
FriOI GRGCYC 1 cut(s) 729
FspBI CTAG 1 cut(s) 762
GlaI GCGC 1 cut(s) 705
GsaI CCCAGC 3 cut(s) 350, 643, 942
GsuI CTGGAG 3 cut(s) 536, 705, 1047
HaeIII GGCC 2 cut(s) 882, 966
HapII CCGG 2 cut(s) 282, 716
HgaI GACGC 2 cut(s) 178, 345
HhaI GCGC 1 cut(s) 706
Hin1I GRCGYC 1 cut(s) 170
Hin1II CATG 7 cut(s) 80, 94, 148, 395, 887, 959, 1062
Hin6I GCGC 1 cut(s) 704
HinP1I GCGC 1 cut(s) 704
HinfI GANTC 4 cut(s) 247, 401, 770, 945
HpaII CCGG 2 cut(s) 282, 716
HphI GGTGA 4 cut(s) 122, 271, 705, 881
Hpy166II GTNNAC 3 cut(s) 15, 823, 1133
Hpy188I TCNGA 6 cut(s) 45, 214, 304, 406, 478, 950
Hpy188III TCNNGA 4 cut(s) 398, 482, 502, 1111
Hpy8I GTNNAC 3 cut(s) 15, 823, 1133
Hpy99I CGWCG 3 cut(s) 172, 229, 1076
HpyAV CCTTC 3 cut(s) 413, 483, 794
HpyCH4III ACNGT 3 cut(s) 584, 601, 747
HpyCH4IV ACGT 1 cut(s) 1135
HpyCH4V TGCA 5 cut(s) 133, 148, 335, 959, 1133
HpyF10VI GCNNNNNNNGC 4 cut(s) 65, 314, 341, 703
HpyF3I CTNAG 4 cut(s) 98, 255, 1009, 1085
HpySE526I ACGT 1 cut(s) 1135
Hsp92I GRCGYC 1 cut(s) 170
Hsp92II CATG 7 cut(s) 80, 94, 148, 395, 887, 959, 1062
HspAI GCGC 1 cut(s) 704
Ksp22I TGATCA 2 cut(s) 394, 886
Kzo9I GATC 6 cut(s) 45, 394, 478, 627, 886, 1075
LmnI GCTCC 2 cut(s) 724, 1037
Lsp1109I GCAGC 6 cut(s) 174, 304, 347, 386, 881, 1013
LweI GCATC 3 cut(s) 295, 304, 322
MaeI CTAG 1 cut(s) 762
MaeII ACGT 1 cut(s) 1135
MaeIII GTNAC 2 cut(s) 192, 747
MalI GATC 6 cut(s) 47, 396, 480, 629, 888, 1077
MboI GATC 6 cut(s) 45, 394, 478, 627, 886, 1075
MboII GAAGA 2 cut(s) 92, 826
MfeI CAATTG 1 cut(s) 351
MhlI GDGCHC 2 cut(s) 729, 1135
MlsI TGGCCA 1 cut(s) 966
MluCI AATT 3 cut(s) 265, 351, 644
MluNI TGGCCA 1 cut(s) 966
MlyI GAGTC 2 cut(s) 410, 764
MmeI TCCRAC 4 cut(s) 384, 384, 605, 679
Mox20I TGGCCA 1 cut(s) 966
Mph1103I ATGCAT 1 cut(s) 961
MscI TGGCCA 1 cut(s) 966
MseI TTAA 2 cut(s) 123, 218
MslI CAYNNNNRTG 3 cut(s) 788, 894, 960
Msp20I TGGCCA 1 cut(s) 966
MspA1I CMGCKG 2 cut(s) 241, 377
MspI CCGG 2 cut(s) 282, 716
MspR9I CCNGG 6 cut(s) 458, 515, 615, 723, 845, 968
MunI CAATTG 1 cut(s) 351
MvaI CCWGG 6 cut(s) 458, 515, 615, 723, 845, 968
MwoI GCNNNNNNNGC 4 cut(s) 65, 314, 341, 703
NdeI CATATG 1 cut(s) 961
NdeII GATC 6 cut(s) 45, 394, 478, 627, 886, 1075
NlaIII CATG 7 cut(s) 80, 94, 148, 395, 887, 959, 1062
NlaIV GGNNCC 3 cut(s) 389, 653, 720
NmuCI GTSAC 1 cut(s) 192
NsiI ATGCAT 1 cut(s) 961
NspI RCATGY 1 cut(s) 148
OliI CACNNNNGTG 1 cut(s) 788
PcsI WCGNNNNNNNCGW 2 cut(s) 23, 410
PfeI GAWTC 2 cut(s) 247, 945
PleI GAGTC 2 cut(s) 409, 764
PpsI GAGTC 2 cut(s) 409, 764
Ppu21I YACGTR 1 cut(s) 1136
Psp6I CCWGG 6 cut(s) 456, 513, 613, 721, 843, 966
PspFI CCCAGC 3 cut(s) 346, 639, 938
PspGI CCWGG 6 cut(s) 456, 513, 613, 721, 843, 966
PspN4I GGNNCC 3 cut(s) 389, 653, 720
PspPI GGNCC 3 cut(s) 406, 1113, 1157
PsrI GAACNNNNNNTAC 2 cut(s) 513, 545
PvuII CAGCTG 1 cut(s) 377
RsaI GTAC 1 cut(s) 1090
RsaNI GTAC 1 cut(s) 1089
RseI CAYNNNNRTG 3 cut(s) 788, 894, 960
SaqAI TTAA 2 cut(s) 123, 218
Sau3AI GATC 6 cut(s) 45, 394, 478, 627, 886, 1075
Sau96I GGNCC 3 cut(s) 406, 1113, 1157
ScaI AGTACT 1 cut(s) 1090
SchI GAGTC 2 cut(s) 410, 764
ScrFI CCNGG 6 cut(s) 458, 515, 615, 723, 845, 968
SduI GDGCHC 2 cut(s) 729, 1135
SfaNI GCATC 3 cut(s) 295, 304, 322
SinI GGWCC 3 cut(s) 406, 1113, 1157
SmiMI CAYNNNNRTG 3 cut(s) 788, 894, 960
Sse9I AATT 3 cut(s) 265, 351, 644
SspMI CTAG 1 cut(s) 762
StyD4I CCNGG 6 cut(s) 456, 513, 613, 721, 843, 966
TaaI ACNGT 3 cut(s) 584, 601, 747
TaiI ACGT 1 cut(s) 1138
TaqI TCGA 2 cut(s) 413, 1071
TasI AATT 3 cut(s) 265, 351, 644
TatI WGTACW 1 cut(s) 1088
TauI GCSGC 5 cut(s) 23, 26, 62, 65, 68
TfiI GAWTC 2 cut(s) 247, 945
Tru1I TTAA 2 cut(s) 123, 218
Tru9I TTAA 2 cut(s) 123, 218
TscAI CASTG 1 cut(s) 589
TseFI GTSAC 1 cut(s) 192
TseI GCWGC 6 cut(s) 187, 317, 335, 374, 869, 1001
Tsp45I GTSAC 1 cut(s) 192
TspDTI ATGAA 4 cut(s) 93, 259, 443, 704
TspGWI ACGGA 3 cut(s) 326, 357, 808
TspRI CASTG 1 cut(s) 589
VneI GTGCAC 1 cut(s) 1131
VpaK11BI GGWCC 3 cut(s) 406, 1113, 1157
XceI RCATGY 1 cut(s) 148
XspI CTAG 1 cut(s) 762
ZrmI AGTACT 1 cut(s) 1090
Zsp2I ATGCAT 1 cut(s) 961
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.