Rmu_ssc0000322.1_g000028

Tetratricopeptide repeat

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000322.1
Physical Location & Seq
Reverse (-)
148754 .. 149826
1073 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000322.1_g000028.1.cds

Sequence Viewer

Length: 354 bp
atgatgctattgagggaagaaaggctagggacagctagccctgaggtggatgatgagaaaagaaggttggctgacttattgaaagaaacaggcagacttcggaacagaaaagccagatcactagagaacctccttgaggccaactctcatggtataaacaatgatcgaattaagtgtttgttaattgctttgattggtttaatttactgcagtgaagacataggaacaatgaagttcaatttgctggtgagcttaaactcaagggttatagctaccggttggagattcaccagaaataacaacaaatttatgctttcaaatactactatattcaggtctgacaacacaatgtag
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

13.46

Weight (kDa)

9.68

Isoelectric Point (pI)

37.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017040)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 305
AfiI CCNNNNNNNGG 2 cut(s) 46, 136
AgeI ACCGGT 1 cut(s) 275
AgsI TTSAA 3 cut(s) 82, 238, 318
AjuI GAANNNNNNNTTGG 2 cut(s) 50, 82
AluBI AGCT 3 cut(s) 35, 252, 272
AluI AGCT 3 cut(s) 35, 252, 272
AoxI GGCC 1 cut(s) 138
ApoI RAATTY 1 cut(s) 305
AsiGI ACCGGT 1 cut(s) 275
AsuHPI GGTGA 2 cut(s) 259, 280
AsuNHI GCTAGC 1 cut(s) 35
AxyI CCTNAGG 1 cut(s) 42
BbsI GAAGAC 1 cut(s) 222
BfaI CTAG 3 cut(s) 26, 36, 122
BfmI CTRYAG 1 cut(s) 208
BmtI GCTAGC 1 cut(s) 39
BpiI GAAGAC 1 cut(s) 222
BplI GAGNNNNNCTC 2 cut(s) 128, 160
BpuEI CTTGAG 2 cut(s) 155, 244
BsaWI WCCGGW 1 cut(s) 275
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 136
Bse118I RCCGGY 1 cut(s) 275
Bse21I CCTNAGG 1 cut(s) 42
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 2 cut(s) 46, 136
BseMII CTCAG 1 cut(s) 33
BshFI GGCC 1 cut(s) 140
BshTI ACCGGT 1 cut(s) 275
BsiSI CCGG 1 cut(s) 276
BslFI GGGAC 1 cut(s) 43
BslI CCNNNNNNNGG 2 cut(s) 46, 136
BsmFI GGGAC 1 cut(s) 43
BsnI GGCC 1 cut(s) 140
Bsp143I GATC 2 cut(s) 116, 163
BspANI GGCC 1 cut(s) 140
BspCNI CTCAG 1 cut(s) 34
BspMAI CTGCAG 1 cut(s) 212
BspOI GCTAGC 1 cut(s) 39
BsrFI RCCGGY 1 cut(s) 275
BssAI RCCGGY 1 cut(s) 275
BssMI GATC 2 cut(s) 116, 163
BstC8I GCNNGC 1 cut(s) 37
BstDEI CTNAG 1 cut(s) 42
BstENI CCTNNNNNAGG 1 cut(s) 134
BstF5I GGATG 1 cut(s) 55
BstKTI GATC 2 cut(s) 119, 166
BstMBI GATC 2 cut(s) 116, 163
BstSFI CTRYAG 1 cut(s) 208
BstV2I GAAGAC 1 cut(s) 222
Bsu36I CCTNAGG 1 cut(s) 42
BsuRI GGCC 1 cut(s) 140
BtsCI GGATG 1 cut(s) 55
BtsI GCAGTG 1 cut(s) 217
BtsIMutI CAGTG 1 cut(s) 217
Cac8I GCNNGC 1 cut(s) 37
Cfr10I RCCGGY 1 cut(s) 275
CspAI ACCGGT 1 cut(s) 275
CviAII CATG 1 cut(s) 149
CviJI RGCY 8 cut(s) 25, 35, 39, 71, 113, 140, 252, 272
CviKI_1 RGCY 8 cut(s) 25, 35, 39, 71, 113, 140, 252, 272
DdeI CTNAG 1 cut(s) 42
DpnI GATC 2 cut(s) 118, 165
DpnII GATC 2 cut(s) 116, 163
Eco81I CCTNAGG 1 cut(s) 42
EcoNI CCTNNNNNAGG 1 cut(s) 134
FaeI CATG 1 cut(s) 152
FaiI YATR 6 cut(s) 150, 155, 221, 269, 311, 329
FaqI GGGAC 1 cut(s) 43
FatI CATG 1 cut(s) 148
FokI GGATG 1 cut(s) 62
FspBI CTAG 3 cut(s) 26, 36, 122
HaeIII GGCC 1 cut(s) 140
HapII CCGG 1 cut(s) 276
Hin1II CATG 1 cut(s) 152
HinfI GANTC 1 cut(s) 285
HpaII CCGG 1 cut(s) 276
HphI GGTGA 2 cut(s) 259, 280
Hpy188I TCNGA 2 cut(s) 102, 340
HpyAV CCTTC 1 cut(s) 57
HpyCH4V TGCA 1 cut(s) 210
HpyF3I CTNAG 1 cut(s) 42
Hsp92II CATG 1 cut(s) 152
Kzo9I GATC 2 cut(s) 116, 163
LpnPI CCDG 7 cut(s) 54, 75, 127, 230, 289, 304, 319
MaeI CTAG 3 cut(s) 26, 36, 122
MalI GATC 2 cut(s) 118, 165
MboI GATC 2 cut(s) 116, 163
MboII GAAGA 2 cut(s) 29, 227
MluCI AATT 5 cut(s) 168, 183, 201, 238, 305
MmeI TCCRAC 1 cut(s) 260
MnlI CCTC 4 cut(s) 6, 37, 130, 140
MseI TTAA 4 cut(s) 171, 182, 200, 254
MspI CCGG 1 cut(s) 276
NdeII GATC 2 cut(s) 116, 163
NheI GCTAGC 1 cut(s) 35
NlaIII CATG 1 cut(s) 152
PfeI GAWTC 1 cut(s) 285
PinAI ACCGGT 1 cut(s) 275
PstI CTGCAG 1 cut(s) 212
SaqAI TTAA 4 cut(s) 171, 182, 200, 254
Sau3AI GATC 2 cut(s) 116, 163
SetI ASST 7 cut(s) 37, 48, 68, 132, 254, 274, 338
SfcI CTRYAG 1 cut(s) 208
SmlI CTYRAG 2 cut(s) 134, 259
SmoI CTYRAG 2 cut(s) 134, 259
Sse9I AATT 5 cut(s) 168, 183, 201, 238, 305
SspMI CTAG 3 cut(s) 26, 36, 122
TaqI TCGA 1 cut(s) 166
TasI AATT 5 cut(s) 168, 183, 201, 238, 305
TfiI GAWTC 1 cut(s) 285
Tru1I TTAA 4 cut(s) 171, 182, 200, 254
Tru9I TTAA 4 cut(s) 171, 182, 200, 254
TscAI CASTG 1 cut(s) 217
TspDTI ATGAA 1 cut(s) 245
TspRI CASTG 1 cut(s) 217
XagI CCTNNNNNAGG 1 cut(s) 134
XapI RAATTY 1 cut(s) 305
XspI CTAG 3 cut(s) 26, 36, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.