Rh7DG192700

Tetratricopeptide repeat

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
18009116 .. 18015463
6348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG192700.1

Sequence Viewer

Length: 252 bp
ATGATAGACATGCGAAGAAATGAACAACTCAAGCAAACAAGTTACTTTTTTTTAGAAAAGCAAACAGGTTCAATGATGCAATTGAGGGAAGAAAGGCTAGGGACAGCTAGCCCTGAGGTGGATGATGAGAAAAGAAGGTTGGCTGACTTATTGAAAGAAACAGGCAGACTTTGGAACAGAAAAGCCAGATCACTAGAGAACCTCCTTGAGGCCAACTCTGATGGTATAAACAATGATCGAATTAAGGTATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.8

Weight (kDa)

8.07

Isoelectric Point (pI)

46.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017040)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 118, 208
AgsI TTSAA 2 cut(s) 72, 154
AjuI GAANNNNNNNTTGG 2 cut(s) 122, 154
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
AoxI GGCC 1 cut(s) 210
AsuNHI GCTAGC 1 cut(s) 107
AxyI CCTNAGG 1 cut(s) 114
BccI CCATC 1 cut(s) 215
BfaI CTAG 3 cut(s) 98, 108, 194
BmsI GCATC 1 cut(s) 66
BmtI GCTAGC 1 cut(s) 111
BplI GAGNNNNNCTC 2 cut(s) 200, 232
BpuEI CTTGAG 2 cut(s) 14, 227
Bsc4I CCNNNNNNNGG 2 cut(s) 118, 208
Bse21I CCTNAGG 1 cut(s) 114
BseGI GGATG 1 cut(s) 127
BseLI CCNNNNNNNGG 2 cut(s) 118, 208
BseMII CTCAG 1 cut(s) 105
BshFI GGCC 1 cut(s) 212
BslFI GGGAC 1 cut(s) 115
BslI CCNNNNNNNGG 2 cut(s) 118, 208
BsmFI GGGAC 1 cut(s) 115
BsnI GGCC 1 cut(s) 212
Bsp143I GATC 2 cut(s) 188, 235
BspANI GGCC 1 cut(s) 212
BspCNI CTCAG 1 cut(s) 106
BspOI GCTAGC 1 cut(s) 111
BssMI GATC 2 cut(s) 188, 235
BstC8I GCNNGC 1 cut(s) 109
BstDEI CTNAG 1 cut(s) 114
BstENI CCTNNNNNAGG 1 cut(s) 206
BstF5I GGATG 1 cut(s) 127
BstKTI GATC 2 cut(s) 191, 238
BstMBI GATC 2 cut(s) 188, 235
BstNSI RCATGY 1 cut(s) 13
Bsu36I CCTNAGG 1 cut(s) 114
BsuRI GGCC 1 cut(s) 212
BtsCI GGATG 1 cut(s) 127
Cac8I GCNNGC 1 cut(s) 109
CviAII CATG 1 cut(s) 10
CviJI RGCY 6 cut(s) 97, 107, 111, 143, 185, 212
CviKI_1 RGCY 6 cut(s) 97, 107, 111, 143, 185, 212
DdeI CTNAG 1 cut(s) 114
DpnI GATC 2 cut(s) 190, 237
DpnII GATC 2 cut(s) 188, 235
Eco81I CCTNAGG 1 cut(s) 114
EcoNI CCTNNNNNAGG 1 cut(s) 206
FaeI CATG 1 cut(s) 13
FaiI YATR 3 cut(s) 11, 227, 250
FaqI GGGAC 1 cut(s) 115
FatI CATG 1 cut(s) 9
FokI GGATG 1 cut(s) 134
FspBI CTAG 3 cut(s) 98, 108, 194
HaeIII GGCC 1 cut(s) 212
Hin1II CATG 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 220
HpyAV CCTTC 1 cut(s) 129
HpyCH4V TGCA 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 1 cut(s) 13
Kzo9I GATC 2 cut(s) 188, 235
LpnPI CCDG 4 cut(s) 51, 126, 147, 199
LweI GCATC 1 cut(s) 66
MaeI CTAG 3 cut(s) 98, 108, 194
MaeIII GTNAC 1 cut(s) 41
MalI GATC 2 cut(s) 190, 237
MboI GATC 2 cut(s) 188, 235
MboII GAAGA 2 cut(s) 27, 101
MfeI CAATTG 1 cut(s) 80
MluCI AATT 2 cut(s) 80, 240
MnlI CCTC 4 cut(s) 78, 109, 202, 212
MseI TTAA 1 cut(s) 243
MunI CAATTG 1 cut(s) 80
NdeII GATC 2 cut(s) 188, 235
NheI GCTAGC 1 cut(s) 107
NlaIII CATG 1 cut(s) 13
NspI RCATGY 1 cut(s) 13
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 2 cut(s) 188, 235
SetI ASST 6 cut(s) 70, 109, 120, 140, 204, 249
SfaNI GCATC 1 cut(s) 66
SmlI CTYRAG 2 cut(s) 29, 206
SmoI CTYRAG 2 cut(s) 29, 206
Sse9I AATT 2 cut(s) 80, 240
SspMI CTAG 3 cut(s) 98, 108, 194
TaqI TCGA 1 cut(s) 238
TasI AATT 2 cut(s) 80, 240
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TspDTI ATGAA 1 cut(s) 36
XagI CCTNNNNNAGG 1 cut(s) 206
XceI RCATGY 1 cut(s) 13
XspI CTAG 3 cut(s) 98, 108, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.