Rmu_ssc0000335.1_g000004

proline-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000335.1
Physical Location & Seq
Forward (+)
9690 .. 11592
1903 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000335.1_g000004.1.cds

Sequence Viewer

Length: 738 bp
atgtatgcacaatcagagtctggagcaagcaattcaagatcatggttcacatatgaagaactgatccaagccacaaatggattttcaaaacagaatcttttgggtgaagggggatttggttgtgtgtacaaaggtatcctggaagatggaagagaagttgctgttaaacagctaaaaattggtggtggacaaggggaacgtgagttccgagctgaagttgaaattatcagtcgagtacaccatcgccatttggtttccctggtgggttactgtatatctgagcatcaaaggttgcttgtctacgactttgttccaaacgatacccttcattaccatcttcatggtcaggatatgccgattatggattgggcaactagagtcaaagttgctgctggtgcagctcgtgggatagcttacttacatgaagattgccatcctcgcattattcatagagatatcaagtcatcaaacatacttctggatagcaattttgaagctcaggttgcagatttcgggcttgcaaagctagcattggatacaaatacacatgtaaccacacgagtcatgggaacatttggatacatggctccagaatatgcaacaagtggaaagttgacagataagtctgatgtttattcttatggcgttgtacttttggagctgattactggtcgcaagcctgtggatggctctcagccattgggtgatgagagccttgttgaatgggtaaattcataa

Protein Analysis

245

Amino Acids

27.2

Weight (kDa)

5.75

Isoelectric Point (pI)

30.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 622
AccI GTMKAC 1 cut(s) 300
AclWI GGATC 1 cut(s) 58
AcsI RAATTY 1 cut(s) 730
AcuI CTGAAG 1 cut(s) 234
AfaI GTAC 3 cut(s) 128, 237, 651
AfiI CCNNNNNNNGG 1 cut(s) 686
AflIII ACRYGT 1 cut(s) 547
AgsI TTSAA 5 cut(s) 36, 87, 221, 494, 722
AjnI CCWGG 2 cut(s) 138, 258
AjuI GAANNNNNNNTTGG 2 cut(s) 99, 131
AloI GAACNNNNNNTCC 4 cut(s) 188, 189, 220, 221
AluBI AGCT 7 cut(s) 172, 212, 401, 413, 497, 526, 661
AluI AGCT 7 cut(s) 172, 212, 401, 413, 497, 526, 661
AlwI GGATC 1 cut(s) 58
AlwNI CAGNNNCTG 1 cut(s) 20
ApeKI GCWGC 2 cut(s) 389, 398
ApoI RAATTY 1 cut(s) 730
AsuHPI GGTGA 2 cut(s) 116, 716
AsuNHI GCTAGC 1 cut(s) 526
BaeI ACNNNNGTAYC 2 cut(s) 118, 151
BauI CACGAG 2 cut(s) 402, 558
BbvI GCAGC 2 cut(s) 376, 410
BccI CCATC 5 cut(s) 140, 249, 342, 441, 680
BciT130I CCWGG 2 cut(s) 140, 260
BciVI GTATCC 3 cut(s) 146, 529, 572
BfaI CTAG 2 cut(s) 375, 527
BfuI GTATCC 3 cut(s) 146, 529, 572
BisI GCNGC 2 cut(s) 390, 399
BlsI GCNGC 2 cut(s) 391, 400
Bme1390I CCNGG 2 cut(s) 140, 260
BmiI GGNNCC 1 cut(s) 588
BmrFI CCNGG 2 cut(s) 140, 260
BmsI GCATC 1 cut(s) 292
BmtI GCTAGC 1 cut(s) 530
BpmI CTGGAG 2 cut(s) 42, 573
Bpu10I CCTNAGC 1 cut(s) 498
BsaBI GATNNNNATC 1 cut(s) 432
BsaJI CCNNGG 1 cut(s) 258
Bsc4I CCNNNNNNNGG 1 cut(s) 686
Bse1I ACTGG 1 cut(s) 673
Bse8I GATNNNNATC 1 cut(s) 432
BseBI CCWGG 2 cut(s) 140, 260
BseDI CCNNGG 1 cut(s) 258
BseGI GGATG 2 cut(s) 433, 691
BseJI GATNNNNATC 1 cut(s) 432
BseLI CCNNNNNNNGG 1 cut(s) 686
BseMII CTCAG 3 cut(s) 270, 512, 707
BseNI ACTGG 1 cut(s) 673
BseXI GCAGC 2 cut(s) 376, 410
BsgI GTGCAG 1 cut(s) 417
BslI CCNNNNNNNGG 1 cut(s) 686
Bsp1407I TGTACA 1 cut(s) 126
Bsp143I GATC 2 cut(s) 38, 63
BspCNI CTCAG 3 cut(s) 271, 511, 706
BspLI GGNNCC 1 cut(s) 588
BspOI GCTAGC 1 cut(s) 530
BspPI GGATC 1 cut(s) 58
BsrGI TGTACA 1 cut(s) 126
BsrI ACTGG 1 cut(s) 673
BssECI CCNNGG 1 cut(s) 258
BssMI GATC 2 cut(s) 38, 63
BssSI CACGAG 2 cut(s) 402, 558
Bst2BI CACGAG 2 cut(s) 402, 558
Bst2UI CCWGG 2 cut(s) 140, 260
Bst4CI ACNGT 1 cut(s) 272
Bst6I CTCTTC 1 cut(s) 145
BstAUI TGTACA 1 cut(s) 126
BstC8I GCNNGC 4 cut(s) 28, 519, 528, 677
BstDEI CTNAG 3 cut(s) 279, 498, 693
BstF5I GGATG 2 cut(s) 433, 691
BstKTI GATC 2 cut(s) 41, 66
BstMBI GATC 2 cut(s) 38, 63
BstMWI GCNNNNNNNGC 6 cut(s) 395, 398, 438, 503, 523, 527
BstNI CCWGG 2 cut(s) 140, 260
BstNSI RCATGY 1 cut(s) 551
BstSCI CCNGG 2 cut(s) 138, 258
BstV1I GCAGC 2 cut(s) 376, 410
BstXI CCANNNNNNTGG 1 cut(s) 341
BsuI GTATCC 3 cut(s) 146, 529, 572
BtgZI GCGATG 1 cut(s) 227
BtsCI GGATG 2 cut(s) 433, 691
Cac8I GCNNGC 4 cut(s) 28, 519, 528, 677
CaiI CAGNNNCTG 1 cut(s) 20
Csp6I GTAC 3 cut(s) 127, 236, 650
CviAII CATG 6 cut(s) 42, 341, 422, 548, 565, 583
CviQI GTAC 3 cut(s) 127, 236, 650
DdeI CTNAG 3 cut(s) 279, 498, 693
DpnI GATC 2 cut(s) 40, 65
DpnII GATC 2 cut(s) 38, 63
DrdI GACNNNNNNGTC 1 cut(s) 622
DseDI GACNNNNNNGTC 1 cut(s) 622
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
Eco32I GATATC 1 cut(s) 457
Eco57I CTGAAG 1 cut(s) 234
EcoRII CCWGG 2 cut(s) 138, 258
EcoRV GATATC 1 cut(s) 457
FaeI CATG 6 cut(s) 45, 344, 425, 551, 568, 586
FatI CATG 6 cut(s) 41, 340, 421, 547, 564, 582
FauNDI CATATG 1 cut(s) 52
FblI GTMKAC 1 cut(s) 300
Fnu4HI GCNGC 2 cut(s) 390, 399
FokI GGATG 2 cut(s) 420, 698
Fsp4HI GCNGC 2 cut(s) 390, 399
FspBI CTAG 2 cut(s) 375, 527
GluI GCNGC 2 cut(s) 390, 399
GsuI CTGGAG 2 cut(s) 42, 573
Hin1II CATG 6 cut(s) 45, 344, 425, 551, 568, 586
HincII GTYRAC 1 cut(s) 615
HindII GTYRAC 1 cut(s) 615
HinfI GANTC 4 cut(s) 17, 94, 378, 561
HphI GGTGA 2 cut(s) 116, 716
Hpy166II GTNNAC 6 cut(s) 48, 127, 188, 238, 301, 615
Hpy188I TCNGA 4 cut(s) 16, 209, 280, 628
Hpy188III TCNNGA 5 cut(s) 21, 36, 347, 479, 590
Hpy8I GTNNAC 6 cut(s) 48, 127, 188, 238, 301, 615
HpyAV CCTTC 2 cut(s) 101, 335
HpyCH4III ACNGT 1 cut(s) 272
HpyCH4IV ACGT 1 cut(s) 199
HpyCH4V TGCA 5 cut(s) 8, 398, 506, 521, 599
HpyF10VI GCNNNNNNNGC 6 cut(s) 395, 398, 438, 503, 523, 527
HpyF3I CTNAG 3 cut(s) 279, 498, 693
HpySE526I ACGT 1 cut(s) 199
Hsp92II CATG 6 cut(s) 45, 344, 425, 551, 568, 586
Kzo9I GATC 2 cut(s) 38, 63
LmnI GCTCC 3 cut(s) 23, 592, 658
Lsp1109I GCAGC 2 cut(s) 376, 410
LweI GCATC 1 cut(s) 292
MaeI CTAG 2 cut(s) 375, 527
MaeII ACGT 1 cut(s) 199
MaeIII GTNAC 2 cut(s) 266, 550
MalI GATC 2 cut(s) 40, 65
MboI GATC 2 cut(s) 38, 63
MboII GAAGA 5 cut(s) 68, 155, 162, 329, 437
MluCI AATT 5 cut(s) 31, 177, 222, 487, 730
MlyI GAGTC 3 cut(s) 26, 387, 570
MnlI CCTC 1 cut(s) 447
MseI TTAA 1 cut(s) 165
MslI CAYNNNNRTG 1 cut(s) 339
MspR9I CCNGG 2 cut(s) 140, 260
MvaI CCWGG 2 cut(s) 140, 260
MwoI GCNNNNNNNGC 6 cut(s) 395, 398, 438, 503, 523, 527
NdeI CATATG 1 cut(s) 52
NdeII GATC 2 cut(s) 38, 63
NheI GCTAGC 1 cut(s) 526
NlaIII CATG 6 cut(s) 45, 344, 425, 551, 568, 586
NlaIV GGNNCC 1 cut(s) 588
NspI RCATGY 1 cut(s) 551
PciI ACATGT 1 cut(s) 547
PcsI WCGNNNNNNNCGW 1 cut(s) 205
PfeI GAWTC 1 cut(s) 94
PfoI TCCNGGA 1 cut(s) 138
PkrI GCNGC 2 cut(s) 391, 400
PleI GAGTC 3 cut(s) 25, 386, 569
PpsI GAGTC 3 cut(s) 25, 386, 569
PscI ACATGT 1 cut(s) 547
Psp6I CCWGG 2 cut(s) 138, 258
PspGI CCWGG 2 cut(s) 138, 258
PspN4I GGNNCC 1 cut(s) 588
PstNI CAGNNNCTG 1 cut(s) 20
RsaI GTAC 3 cut(s) 128, 237, 651
RsaNI GTAC 3 cut(s) 127, 236, 650
RseI CAYNNNNRTG 1 cut(s) 339
SaqAI TTAA 1 cut(s) 165
SatI GCNGC 2 cut(s) 390, 399
Sau3AI GATC 2 cut(s) 38, 63
SchI GAGTC 3 cut(s) 26, 387, 570
ScrFI CCNGG 2 cut(s) 140, 260
SfaNI GCATC 1 cut(s) 292
SmiMI CAYNNNNRTG 1 cut(s) 339
Sse9I AATT 5 cut(s) 31, 177, 222, 487, 730
SspMI CTAG 2 cut(s) 375, 527
StyD4I CCNGG 2 cut(s) 138, 258
TaaI ACNGT 1 cut(s) 272
TaiI ACGT 1 cut(s) 202
TaqI TCGA 1 cut(s) 232
TasI AATT 5 cut(s) 31, 177, 222, 487, 730
TatI WGTACW 3 cut(s) 126, 235, 649
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TseI GCWGC 2 cut(s) 389, 398
TspDTI ATGAA 6 cut(s) 69, 317, 329, 437, 438, 723
XapI RAATTY 1 cut(s) 730
XceI RCATGY 1 cut(s) 551
XcmI CCANNNNNNNNNTGG 2 cut(s) 74, 562
XmiI GTMKAC 1 cut(s) 300
XspI CTAG 2 cut(s) 375, 527
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.