Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000337.1

Orthogroup ID

OG0014813

Physical Location & Seq

Genomic Coordinates Forward (+)

11670 .. 12125

Gene Structure 456 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 456 bp

atggtcatcgttgtagctatcacagcaaccaggaaacttctaatcactcacacttccattcatgctatcagagaccgagagatgaacatgcaggggctagaggagaagagtattgtgagttcaacgacgacttcaactgtagtcgagaagaatcctgctgtagctggcaatataatgtcactatctccacctgaaacctactcgcttgagaatacaggtacttatagaagtgaaccaatgatagaagaaccagcaacaccacatcaagaattcagtaacctatcactgagcgacattgaagacttggtctctgaggagcctggtgagatgcctaccatcactgtcaacatggaagtgttcacagacacattacgaaactatatgcaaaagaacatgaatctccaaaaaggtgacatgtccaaggcattagatgccaacaatggaaaacaaaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0003906 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006139 GO:0006259 GO:0006304 GO:0006305 GO:0006306 GO:0006349 GO:0006725 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009790 GO:0009791 GO:0009793 GO:0009987 GO:0010154 GO:0010468 GO:0016787 GO:0016798 GO:0016799 GO:0019104 GO:0019222 GO:0022414 GO:0032259 GO:0032501 GO:0032502 GO:0034641 GO:0040029 GO:0043076 GO:0043078 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043414 GO:0044237 GO:0044238 GO:0044260 GO:0044424 GO:0044464 GO:0044728 GO:0046483 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0050789 GO:0060255 GO:0061458 GO:0065007 GO:0071514 GO:0071704 GO:0090304 GO:0140097 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Perm-CXXC RRM_DME

Protein Analysis

151

Amino Acids

16.75

Weight (kDa)

4.84

Isoelectric Point (pI)

53.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014813)

Species	Orthologous Gene IDs
malus_domestica	MD02G1245400.v1.1
rosa_laevigata	RLG00000014016 RLG00000019259
rosa_multiflora	Rmu_co8185588.1_g000001 Rmu_co8508999.1_g000001 Rmu_sc0001630.1_g000014 Rmu_sc0010408.1_g000007 Rmu_ssc0000337.1_g000003 Rmu_ssc0000388.1_g000059
rosa_rugosa	Rorug05G0177000 Rorug05G0286700 Rorug05G0373900 Rorug06G0018300
rosa_samantha	Rh4DG130200 Rh5AG315000 Rh6AG152900 Rh6CG148900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	269
AfaI	GTAC	1 cut(s)	220
AflIII	ACRYGT	1 cut(s)	414
AgsI	TTSAA	3 cut(s)	123, 135, 299
AjnI	CCWGG	2 cut(s)	29, 319
AluBI	AGCT	2 cut(s)	17, 164
AluI	AGCT	2 cut(s)	17, 164
Alw26I	GTCTC	2 cut(s)	66, 313
ApoI	RAATTY	1 cut(s)	269
AsuHPI	GGTGA	2 cut(s)	335, 422
BbsI	GAAGAC	1 cut(s)	306
BccI	CCATC	1 cut(s)	344
BciT130I	CCWGG	2 cut(s)	31, 321
BcoDI	GTCTC	2 cut(s)	66, 313
BfaI	CTAG	1 cut(s)	98
BfmI	CTRYAG	2 cut(s)	138, 159
Bme1390I	CCNGG	2 cut(s)	31, 321
BmiI	GGNNCC	1 cut(s)	318
BmrFI	CCNGG	2 cut(s)	31, 321
BmsI	GCATC	2 cut(s)	318, 421
BpiI	GAAGAC	1 cut(s)	306
BpuEI	CTTGAG	1 cut(s)	227
BsaI	GGTCTC	2 cut(s)	66, 313
BsaJI	CCNNGG	1 cut(s)	420
BseBI	CCWGG	2 cut(s)	31, 321
BseDI	CCNNGG	1 cut(s)	420
BseMII	CTCAG	2 cut(s)	278, 303
BseRI	GAGGAG	2 cut(s)	116, 329
BsmAI	GTCTC	2 cut(s)	66, 313
Bso31I	GGTCTC	2 cut(s)	66, 313
BspCNI	CTCAG	2 cut(s)	279, 304
BspLI	GGNNCC	1 cut(s)	318
BspTNI	GGTCTC	2 cut(s)	66, 313
BssECI	CCNNGG	1 cut(s)	420
BssT1I	CCWWGG	1 cut(s)	420
Bst2UI	CCWGG	2 cut(s)	31, 321
Bst4CI	ACNGT	2 cut(s)	139, 343
Bst6I	CTCTTC	1 cut(s)	101
BstAPI	GCANNNNNTGC	1 cut(s)	431
BstC8I	GCNNGC	1 cut(s)	166
BstDEI	CTNAG	2 cut(s)	287, 312
BstMAI	GTCTC	2 cut(s)	66, 313
BstMWI	GCNNNNNNNGC	2 cut(s)	23, 431
BstNI	CCWGG	2 cut(s)	31, 321
BstNSI	RCATGY	2 cut(s)	91, 418
BstSCI	CCNGG	2 cut(s)	29, 319
BstSFI	CTRYAG	2 cut(s)	138, 159
BstV2I	GAAGAC	1 cut(s)	306
BtsIMutI	CAGTG	2 cut(s)	284, 339
Cac8I	GCNNGC	1 cut(s)	166
Csp6I	GTAC	1 cut(s)	219
CviAII	CATG	5 cut(s)	62, 88, 349, 394, 415
CviJI	RGCY	4 cut(s)	17, 97, 164, 319
CviKI_1	RGCY	4 cut(s)	17, 97, 164, 319
CviQI	GTAC	1 cut(s)	219
DdeI	CTNAG	2 cut(s)	287, 312
Eam1104I	CTCTTC	1 cut(s)	101
EarI	CTCTTC	1 cut(s)	101
Eco130I	CCWWGG	1 cut(s)	420
Eco31I	GGTCTC	2 cut(s)	66, 313
EcoRI	GAATTC	1 cut(s)	269
EcoRII	CCWGG	2 cut(s)	29, 319
EcoT14I	CCWWGG	1 cut(s)	420
ErhI	CCWWGG	1 cut(s)	420
FaeI	CATG	5 cut(s)	65, 91, 352, 397, 418
FaiI	YATR	9 cut(s)	63, 89, 173, 225, 350, 381, 383, 395, 416
FatI	CATG	5 cut(s)	61, 87, 348, 393, 414
FspBI	CTAG	1 cut(s)	98
Hin1II	CATG	5 cut(s)	65, 91, 352, 397, 418
HincII	GTYRAC	1 cut(s)	346
HindII	GTYRAC	1 cut(s)	346
HinfI	GANTC	2 cut(s)	151, 397
HphI	GGTGA	2 cut(s)	335, 422
Hpy166II	GTNNAC	3 cut(s)	233, 346, 360
Hpy188I	TCNGA	2 cut(s)	71, 313
Hpy188III	TCNNGA	2 cut(s)	145, 266
Hpy8I	GTNNAC	3 cut(s)	233, 346, 360
Hpy99I	CGWCG	1 cut(s)	130
HpyCH4III	ACNGT	2 cut(s)	139, 343
HpyCH4V	TGCA	2 cut(s)	91, 385
HpyF10VI	GCNNNNNNNGC	2 cut(s)	23, 431
HpyF3I	CTNAG	2 cut(s)	287, 312
Hsp92II	CATG	5 cut(s)	65, 91, 352, 397, 418
LmnI	GCTCC	1 cut(s)	316
LweI	GCATC	2 cut(s)	318, 421
MaeI	CTAG	1 cut(s)	98
MaeIII	GTNAC	3 cut(s)	177, 275, 410
MboII	GAAGA	4 cut(s)	118, 160, 257, 311
MluCI	AATT	1 cut(s)	269
MnlI	CCTC	2 cut(s)	94, 307
MslI	CAYNNNNRTG	1 cut(s)	353
MspR9I	CCNGG	2 cut(s)	31, 321
MvaI	CCWGG	2 cut(s)	31, 321
MwoI	GCNNNNNNNGC	2 cut(s)	23, 431
NlaIII	CATG	5 cut(s)	65, 91, 352, 397, 418
NlaIV	GGNNCC	1 cut(s)	318
NmuCI	GTSAC	2 cut(s)	177, 410
NspI	RCATGY	2 cut(s)	91, 418
PciI	ACATGT	1 cut(s)	414
PfeI	GAWTC	2 cut(s)	151, 397
PflFI	GACNNNGTC	1 cut(s)	305
PscI	ACATGT	1 cut(s)	414
Psp6I	CCWGG	2 cut(s)	29, 319
PspGI	CCWGG	2 cut(s)	29, 319
PspN4I	GGNNCC	1 cut(s)	318
PsrI	GAACNNNNNNTAC	2 cut(s)	103, 135
PsyI	GACNNNGTC	1 cut(s)	305
RsaI	GTAC	1 cut(s)	220
RsaNI	GTAC	1 cut(s)	219
RseI	CAYNNNNRTG	1 cut(s)	353
ScrFI	CCNGG	2 cut(s)	31, 321
SetI	ASST	7 cut(s)	19, 166, 193, 200, 220, 282, 412
SfaNI	GCATC	2 cut(s)	318, 421
SfcI	CTRYAG	2 cut(s)	138, 159
SmiMI	CAYNNNNRTG	1 cut(s)	353
SmlI	CTYRAG	1 cut(s)	206
SmoI	CTYRAG	1 cut(s)	206
Sse9I	AATT	1 cut(s)	269
SspMI	CTAG	1 cut(s)	98
StyD4I	CCNGG	2 cut(s)	29, 319
StyI	CCWWGG	1 cut(s)	420
TaaI	ACNGT	2 cut(s)	139, 343
TaqI	TCGA	1 cut(s)	144
TaqII	GACCGA	1 cut(s)	90
TasI	AATT	1 cut(s)	269
TfiI	GAWTC	2 cut(s)	151, 397
TscAI	CASTG	2 cut(s)	291, 346
TseFI	GTSAC	2 cut(s)	177, 410
Tsp45I	GTSAC	2 cut(s)	177, 410
TspDTI	ATGAA	3 cut(s)	50, 98, 410
TspRI	CASTG	2 cut(s)	291, 346
Tth111I	GACNNNGTC	1 cut(s)	305
XapI	RAATTY	1 cut(s)	269
XceI	RCATGY	2 cut(s)	91, 418
XspI	CTAG	1 cut(s)	98

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.