Rmu_ssc0000436.1_g000014

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000436.1
OG0015776
Physical Location & Seq
Forward (+)
57729 .. 58034
306 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 306 bp
atgactcgtcataaggatgattcgctccagtacgagtgtatgaatgaagaagaccctagaaggttgtgggtctcactcgaagatagatttggcaacgtccgtgactccctgcttcctaacctagaagtgagatggcatagcctccgcttctgcgatttcaagtcagttcttgactacaactcggaagcacttcgcattaaatccttaatggaattctgtgataaagagatcacaaatgcgatgttgattgagaagactctctctactttccccttctctgcattgatggttgctaagaactattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

101

Amino Acids

12.04

Weight (kDa)

5.35

Isoelectric Point (pI)

64.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 145
AcsI RAATTY 1 cut(s) 212
AfaI GTAC 1 cut(s) 32
AgsI TTSAA 1 cut(s) 160
AjuI GAANNNNNNNTTGG 2 cut(s) 72, 104
Alw26I GTCTC 1 cut(s) 76
ApoI RAATTY 1 cut(s) 212
Asp700I GAANNNNTTC 1 cut(s) 189
BbsI GAAGAC 2 cut(s) 57, 260
BccI CCATC 2 cut(s) 126, 280
BcoDI GTCTC 1 cut(s) 76
BfaI CTAG 2 cut(s) 57, 122
BpiI GAAGAC 2 cut(s) 57, 260
BpmI CTGGAG 1 cut(s) 11
BsaI GGTCTC 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 28
BseGI GGATG 1 cut(s) 22
BseNI ACTGG 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 76
Bso31I GGTCTC 1 cut(s) 76
Bsp143I GATC 1 cut(s) 228
BspACI CCGC 1 cut(s) 145
BspTNI GGTCTC 1 cut(s) 76
BsrI ACTGG 1 cut(s) 28
BssMI GATC 1 cut(s) 228
BstDEI CTNAG 1 cut(s) 294
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 1 cut(s) 231
BstMAI GTCTC 1 cut(s) 76
BstMBI GATC 1 cut(s) 228
BstV2I GAAGAC 2 cut(s) 57, 260
BtgZI GCGATG 1 cut(s) 254
BtsCI GGATG 1 cut(s) 22
Csp6I GTAC 1 cut(s) 31
CviJI RGCY 1 cut(s) 141
CviKI_1 RGCY 1 cut(s) 141
CviQI GTAC 1 cut(s) 31
DdeI CTNAG 1 cut(s) 294
DpnI GATC 1 cut(s) 230
DpnII GATC 1 cut(s) 228
Eco31I GGTCTC 1 cut(s) 76
EcoRI GAATTC 1 cut(s) 212
FaiI YATR 3 cut(s) 12, 41, 138
FokI GGATG 1 cut(s) 29
FspBI CTAG 2 cut(s) 57, 122
GsuI CTGGAG 1 cut(s) 11
HinfI GANTC 4 cut(s) 4, 20, 104, 256
Hpy188I TCNGA 1 cut(s) 184
Hpy188III TCNNGA 1 cut(s) 170
HpyAV CCTTC 2 cut(s) 54, 283
HpyCH4IV ACGT 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 281
HpyF3I CTNAG 1 cut(s) 294
HpySE526I ACGT 1 cut(s) 96
Kzo9I GATC 1 cut(s) 228
LmnI GCTCC 1 cut(s) 30
LpnPI CCDG 2 cut(s) 41, 122
MaeI CTAG 2 cut(s) 57, 122
MaeII ACGT 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 101
MalI GATC 1 cut(s) 230
MboI GATC 1 cut(s) 228
MboII GAAGA 4 cut(s) 59, 62, 92, 265
MluCI AATT 1 cut(s) 212
MlyI GAGTC 2 cut(s) 98, 250
MnlI CCTC 1 cut(s) 152
MroXI GAANNNNTTC 1 cut(s) 189
MseI TTAA 2 cut(s) 198, 206
MslI CAYNNNNRTG 1 cut(s) 15
NdeII GATC 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 101
PdmI GAANNNNTTC 1 cut(s) 189
PfeI GAWTC 1 cut(s) 20
PleI GAGTC 2 cut(s) 98, 250
PpsI GAGTC 2 cut(s) 98, 250
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
RseI CAYNNNNRTG 1 cut(s) 15
SaqAI TTAA 2 cut(s) 198, 206
Sau3AI GATC 1 cut(s) 228
SchI GAGTC 2 cut(s) 98, 250
SetI ASST 3 cut(s) 65, 99, 123
SmiMI CAYNNNNRTG 1 cut(s) 15
Sse9I AATT 1 cut(s) 212
SsiI CCGC 1 cut(s) 145
SspMI CTAG 2 cut(s) 57, 122
TaiI ACGT 1 cut(s) 99
TaqI TCGA 1 cut(s) 78
TasI AATT 1 cut(s) 212
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 2 cut(s) 198, 206
Tru9I TTAA 2 cut(s) 198, 206
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 2 cut(s) 56, 60
TspGWI ACGGA 1 cut(s) 89
XapI RAATTY 1 cut(s) 212
XmnI GAANNNNTTC 1 cut(s) 189
XspI CTAG 2 cut(s) 57, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.