Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000454.1

Orthogroup ID

OG0015242

Physical Location & Seq

Genomic Coordinates Reverse (-)

19405 .. 20224

Gene Structure 820 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000454.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 699 bp

atggctgatcagccacaaccacaagggaatcatcgtggcacttctgaaagccgccgtcgaaaggccacatccgccgccactggaaagcagcagcagcgaacagcggtagatcatcatcttcatcatcatcaatccagtagtactgcagcttcagctccgtgtggggcatgcaagtttttgagaaggaagtgcattagtggttgcatctttgctccccattttggatcagaccagggagccgcgcggtttgctgcggtgcacaaggtgtttggcgcaagtaatgtctcaaagcttttgctgcacatacctttgaaccgcaggaatgatgctgtcgttacaatatcctacgaggctcaagctcgcctctccgacccggttgcatctttacaaaccgagctcgcaatggtgcaaactcagctgataaacagtagatttgcatttgcaaatgccattcaaagctcgcagcagcatcaggaacaacagcaaaacatggcattgctgcagtctgcctactccaataactcatctgcttcgactaacccgatcaacatgaggagcttcacctccaattttaatcatgaactcgcagctgagacagcaccatgttcccacagcttggagcctcttctgctctcaaggccttctcaagatgaagaagaagatgagcaacaaagtcaagtgccccaccattttcgctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0002831 GO:0007154 GO:0007165 GO:0008150 GO:0009719 GO:0009725 GO:0009753 GO:0009755 GO:0009867 GO:0009987 GO:0010033 GO:0023052 GO:0031347 GO:0032101 GO:0032870 GO:0042221 GO:0043900 GO:0048583 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0070887 GO:0071229 GO:0071310 GO:0071395 GO:0071495 GO:0080134 GO:1900150 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LOB

Protein Analysis

232

Amino Acids

25.5

Weight (kDa)

8.7

Isoelectric Point (pI)

63.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015242)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G03760
malus_domestica	MD11G1229500.v1.1 MD12G1009400.v1.1 MD14G1006900.v1.1
prunus_persica	Prupe.7G011300_v2.0.a1
rosa_chinensis	RchiOBHm_Chr3g0496241
rosa_laevigata	RLG00000022544
rosa_multiflora	Rmu_sc0004080.1_g000014 Rmu_ssc0000454.1_g000007
rosa_roxburghii	Rroxscaffold_6G00389310
rosa_rugosa	Rorug03G0281000
rosa_samantha	Rh3AG327900 Rh3BG364100 Rh3CG361000 Rh3DG364000
rosa_wichuraiana	Rw3G028720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	616
AccII	CGCG	2 cut(s)	242, 244
AciI	CCGC	8 cut(s)	52, 72, 75, 104, 240, 244, 254, 316
AclWI	GGATC	1 cut(s)	232
AcuI	CTGAAG	1 cut(s)	135
AdeI	CACNNNGTG	1 cut(s)	265
AfaI	GTAC	1 cut(s)	142
AfiI	CCNNNNNNNGG	3 cut(s)	61, 221, 616
AgsI	TTSAA	2 cut(s)	313, 455
AjnI	CCWGG	1 cut(s)	231
Alw21I	GWGCWC	2 cut(s)	261, 399
Alw26I	GTCTC	2 cut(s)	289, 587
Alw44I	GTGCAC	1 cut(s)	257
AlwI	GGATC	1 cut(s)	232
AoxI	GGCC	2 cut(s)	63, 638
ApaLI	GTGCAC	1 cut(s)	257
AspLEI	GCGC	2 cut(s)	244, 275
AsuC2I	CCSGG	1 cut(s)	374
AsuHPI	GGTGA	1 cut(s)	553
BaeGI	GKGCMC	2 cut(s)	261, 684
BanII	GRGCYC	1 cut(s)	399
BarI	GAAGNNNNNNTAC	2 cut(s)	133, 165
Bbv12I	GWGCWC	2 cut(s)	261, 399
BceAI	ACGGC	1 cut(s)	39
BcgI	CGANNNNNNTGC	2 cut(s)	359, 393
BciT130I	CCWGG	1 cut(s)	233
BclI	TGATCA	1 cut(s)	7
BcnI	CCSGG	1 cut(s)	374
BcoDI	GTCTC	2 cut(s)	289, 587
BfaI	CTAG	1 cut(s)	697
BfmI	CTRYAG	2 cut(s)	144, 500
BmcAI	AGTACT	1 cut(s)	142
Bme1390I	CCNGG	2 cut(s)	233, 374
BmiI	GGNNCC	2 cut(s)	238, 621
BmrFI	CCNGG	2 cut(s)	233, 374
BmsI	GCATC	4 cut(s)	213, 316, 389, 478
BpuEI	CTTGAG	3 cut(s)	339, 619, 630
BpuMI	CCSGG	1 cut(s)	374
BsaBI	GATNNNNATC	1 cut(s)	114
BsaJI	CCNNGG	1 cut(s)	232
Bsc4I	CCNNNNNNNGG	3 cut(s)	61, 221, 616
Bse1I	ACTGG	2 cut(s)	85, 135
Bse3DI	GCAATG	2 cut(s)	408, 494
Bse8I	GATNNNNATC	1 cut(s)	114
BseBI	CCWGG	1 cut(s)	233
BseDI	CCNNGG	1 cut(s)	232
BseGI	GGATG	1 cut(s)	68
BseJI	GATNNNNATC	1 cut(s)	114
BseLI	CCNNNNNNNGG	3 cut(s)	61, 221, 616
BseMI	GCAATG	2 cut(s)	408, 494
BseMII	CTCAG	2 cut(s)	428, 582
BseNI	ACTGG	2 cut(s)	85, 135
BseRI	GAGGAG	1 cut(s)	568
BseSI	GKGCMC	2 cut(s)	261, 684
BsgI	GTGCAG	1 cut(s)	284
Bsh1236I	CGCG	2 cut(s)	242, 244
BshFI	GGCC	2 cut(s)	65, 640
BsiHKAI	GWGCWC	2 cut(s)	261, 399
BsiSI	CCGG	1 cut(s)	374
BslI	CCNNNNNNNGG	3 cut(s)	61, 221, 616
BsmAI	GTCTC	2 cut(s)	289, 587
BsnI	GGCC	2 cut(s)	65, 640
Bsp1286I	GDGCHC	3 cut(s)	261, 399, 684
Bsp143I	GATC	4 cut(s)	7, 109, 224, 543
BspACI	CCGC	8 cut(s)	52, 72, 75, 104, 240, 244, 254, 316
BspANI	GGCC	2 cut(s)	65, 640
BspCNI	CTCAG	2 cut(s)	427, 583
BspFNI	CGCG	2 cut(s)	242, 244
BspHI	TCATGA	1 cut(s)	577
BspLI	GGNNCC	2 cut(s)	238, 621
BspMAI	CTGCAG	2 cut(s)	148, 504
BspPI	GGATC	1 cut(s)	232
BsrDI	GCAATG	2 cut(s)	408, 494
BsrI	ACTGG	2 cut(s)	85, 135
BssECI	CCNNGG	1 cut(s)	232
BssMI	GATC	4 cut(s)	7, 109, 224, 543
Bst2UI	CCWGG	1 cut(s)	233
Bst4CI	ACNGT	1 cut(s)	428
Bst6I	CTCTTC	1 cut(s)	630
BstC8I	GCNNGC	4 cut(s)	169, 361, 399, 461
BstDEI	CTNAG	2 cut(s)	414, 591
BstF5I	GGATG	1 cut(s)	68
BstFNI	CGCG	2 cut(s)	242, 244
BstHHI	GCGC	2 cut(s)	244, 275
BstKTI	GATC	4 cut(s)	10, 112, 227, 546
BstMAI	GTCTC	2 cut(s)	289, 587
BstMBI	GATC	4 cut(s)	7, 109, 224, 543
BstMWI	GCNNNNNNNGC	9 cut(s)	71, 94, 152, 248, 298, 415, 596, 628, 637
BstNI	CCWGG	1 cut(s)	233
BstNSI	RCATGY	1 cut(s)	171
BstSCI	CCNGG	2 cut(s)	231, 372
BstSFI	CTRYAG	2 cut(s)	144, 500
BstSLI	GKGCMC	2 cut(s)	261, 684
BstUI	CGCG	2 cut(s)	242, 244
BsuRI	GGCC	2 cut(s)	65, 640
BtsCI	GGATG	1 cut(s)	68
BtsIMutI	CAGTG	1 cut(s)	78
Cac8I	GCNNGC	4 cut(s)	169, 361, 399, 461
CciI	TCATGA	1 cut(s)	577
CfoI	GCGC	2 cut(s)	244, 275
Csp6I	GTAC	1 cut(s)	141
CviAII	CATG	5 cut(s)	168, 490, 550, 578, 603
CviQI	GTAC	1 cut(s)	141
DdeI	CTNAG	2 cut(s)	414, 591
DpnI	GATC	4 cut(s)	9, 111, 226, 545
DpnII	GATC	4 cut(s)	7, 109, 224, 543
DraIII	CACNNNGTG	1 cut(s)	265
Eam1104I	CTCTTC	1 cut(s)	630
EarI	CTCTTC	1 cut(s)	630
EciI	GGCGGA	1 cut(s)	61
Ecl136II	GAGCTC	1 cut(s)	397
Eco147I	AGGCCT	1 cut(s)	640
Eco24I	GRGCYC	1 cut(s)	399
Eco53kI	GAGCTC	1 cut(s)	397
Eco57I	CTGAAG	1 cut(s)	135
EcoICRI	GAGCTC	1 cut(s)	397
EcoRII	CCWGG	1 cut(s)	231
EcoT38I	GRGCYC	1 cut(s)	399
FaeI	CATG	5 cut(s)	171, 493, 553, 581, 606
FaiI	YATR	6 cut(s)	169, 305, 491, 551, 579, 604
FatI	CATG	5 cut(s)	167, 489, 549, 577, 602
FbaI	TGATCA	1 cut(s)	7
FokI	GGATG	1 cut(s)	55
FriOI	GRGCYC	1 cut(s)	399
FspBI	CTAG	1 cut(s)	697
GlaI	GCGC	2 cut(s)	243, 274
HaeIII	GGCC	2 cut(s)	65, 640
HapII	CCGG	1 cut(s)	374
HhaI	GCGC	2 cut(s)	244, 275
Hin1II	CATG	5 cut(s)	171, 493, 553, 581, 606
Hin6I	GCGC	2 cut(s)	242, 273
HinP1I	GCGC	2 cut(s)	242, 273
HindIII	AAGCTT	1 cut(s)	290
HinfI	GANTC	1 cut(s)	28
HpaII	CCGG	1 cut(s)	374
HphI	GGTGA	1 cut(s)	553
Hpy166II	GTNNAC	1 cut(s)	259
Hpy188I	TCNGA	3 cut(s)	46, 229, 370
Hpy188III	TCNNGA	3 cut(s)	473, 578, 647
Hpy8I	GTNNAC	1 cut(s)	259
Hpy99I	CGWCG	1 cut(s)	60
HpyAV	CCTTC	2 cut(s)	177, 651
HpyCH4III	ACNGT	1 cut(s)	428
HpyF10VI	GCNNNNNNNGC	9 cut(s)	71, 94, 152, 248, 298, 415, 596, 628, 637
HpyF3I	CTNAG	2 cut(s)	414, 591
Hsp92II	CATG	5 cut(s)	171, 493, 553, 581, 606
HspAI	GCGC	2 cut(s)	242, 273
Ksp22I	TGATCA	1 cut(s)	7
Kzo9I	GATC	4 cut(s)	7, 109, 224, 543
LmnI	GCTCC	5 cut(s)	160, 217, 236, 555, 619
LpnPI	CCDG	7 cut(s)	66, 148, 218, 245, 304, 387, 458
LweI	GCATC	4 cut(s)	213, 316, 389, 478
MaeI	CTAG	1 cut(s)	697
MaeIII	GTNAC	1 cut(s)	334
MalI	GATC	4 cut(s)	9, 111, 226, 545
MboI	GATC	4 cut(s)	7, 109, 224, 543
MboII	GAAGA	5 cut(s)	110, 617, 665, 668, 671
MhlI	GDGCHC	3 cut(s)	261, 399, 684
MluCI	AATT	1 cut(s)	568
MmeI	TCCRAC	1 cut(s)	393
MnlI	CCTC	5 cut(s)	343, 374, 546, 574, 633
MseI	TTAA	1 cut(s)	573
MspA1I	CMGCKG	3 cut(s)	104, 418, 590
MspI	CCGG	1 cut(s)	374
MspR9I	CCNGG	2 cut(s)	233, 374
MvaI	CCWGG	1 cut(s)	233
MvnI	CGCG	2 cut(s)	242, 244
MwoI	GCNNNNNNNGC	9 cut(s)	71, 94, 152, 248, 298, 415, 596, 628, 637
NciI	CCSGG	1 cut(s)	374
NdeII	GATC	4 cut(s)	7, 109, 224, 543
NlaIII	CATG	5 cut(s)	171, 493, 553, 581, 606
NlaIV	GGNNCC	2 cut(s)	238, 621
NspI	RCATGY	1 cut(s)	171
PaeI	GCATGC	1 cut(s)	171
PagI	TCATGA	1 cut(s)	577
PceI	AGGCCT	1 cut(s)	640
PcsI	WCGNNNNNNNCGW	1 cut(s)	539
PfeI	GAWTC	1 cut(s)	28
PflMI	CCANNNNNTGG	1 cut(s)	616
Psp124BI	GAGCTC	1 cut(s)	399
Psp6I	CCWGG	1 cut(s)	231
PspGI	CCWGG	1 cut(s)	231
PspN4I	GGNNCC	2 cut(s)	238, 621
PstI	CTGCAG	2 cut(s)	148, 504
PvuII	CAGCTG	2 cut(s)	418, 590
RsaI	GTAC	1 cut(s)	142
RsaNI	GTAC	1 cut(s)	141
SacI	GAGCTC	1 cut(s)	399
SaqAI	TTAA	1 cut(s)	573
Sau3AI	GATC	4 cut(s)	7, 109, 224, 543
ScaI	AGTACT	1 cut(s)	142
ScrFI	CCNGG	2 cut(s)	233, 374
SduI	GDGCHC	3 cut(s)	261, 399, 684
SfaNI	GCATC	4 cut(s)	213, 316, 389, 478
SfcI	CTRYAG	2 cut(s)	144, 500
SmlI	CTYRAG	3 cut(s)	354, 634, 645
SmoI	CTYRAG	3 cut(s)	354, 634, 645
SphI	GCATGC	1 cut(s)	171
Sse9I	AATT	1 cut(s)	568
SseBI	AGGCCT	1 cut(s)	640
SsiI	CCGC	8 cut(s)	52, 72, 75, 104, 240, 244, 254, 316
SspMI	CTAG	1 cut(s)	697
SstI	GAGCTC	1 cut(s)	399
StuI	AGGCCT	1 cut(s)	640
StyD4I	CCNGG	2 cut(s)	231, 372
TaaI	ACNGT	1 cut(s)	428
TaqI	TCGA	2 cut(s)	58, 533
TasI	AATT	1 cut(s)	568
TatI	WGTACW	1 cut(s)	140
TauI	GCSGC	3 cut(s)	54, 77, 242
TfiI	GAWTC	1 cut(s)	28
Tru1I	TTAA	1 cut(s)	573
Tru9I	TTAA	1 cut(s)	573
TscAI	CASTG	1 cut(s)	85
TspDTI	ATGAA	3 cut(s)	110, 594, 666
TspGWI	ACGGA	1 cut(s)	147
TspRI	CASTG	1 cut(s)	85
Van91I	CCANNNNNTGG	1 cut(s)	616
VneI	GTGCAC	1 cut(s)	257
XceI	RCATGY	1 cut(s)	171
XspI	CTAG	1 cut(s)	697
ZrmI	AGTACT	1 cut(s)	142

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.