Rmu_ssc0000480.1_g000013

mediator of RNA polymerase II transcription subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000480.1
OG0010201
Physical Location & Seq
Forward (+)
53432 .. 55529
2098 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1395 bp
atggcgaccacggccaagtctgggtcttcactgaattactggaggaattatttccggacggcgaattccgacattttcggcatcattgaccatgccatcatggttgccgctgtggattgtcccaaggagttcaggttgcggagggatcgagttgctgagctcttgttttcctgcagaatgagcaggtgttcgggttgcgaaaaggtggagttggtggtgcctggtgctcatggtcatggtcatgatgatcactatgaggtggagcatgatgatgatgatgatgatgaccgaggaggtgatagagattttgaggccggggctagtaaagagagcaaggtcaatagcagcagagatgatcagattggtgaaatgagcatgaagaatgatcaggatagcaattacagctatggattggctgaggctttgaccgatgagattgaacaagagtctcaggttttcggggaggttgtgaggatcaaagagatcttccagaatagtgaacatgagtctgatgctgtattgtttgagtcgttgaggaagcttgagttgatggctctgtctgtggagactctcaaggcaactgagattgggaaggctgttaaccggctaagaaagcatggatcaatgaagattcgtaatcttgttcgaacactaattgatgggtggaaagtcatggtagatgaatgggtcaatgctactacagctattgcttctgggggaacagaagttatttcggattctgttgatccatcaattgatgatgactttgaagaaggacttcccactcctccattggatgaaggagctttctttgccactcaaaccacctcaatggaactctctgagttctttgatggtatggaagattatgggaatcctcgaaacagtgggcaacataccaggaatcgtgaaaatggaagaaaaccatcactggagaaacaaaatgttgtgaagcaggaacaacagtatgttagtgatcagggaaatgtgcttcccaagaaaataaaaagtgaaccagtgatggtgaaacaagaagttgatgtgaagccaaataggccctcaaacaccaactctggccctcggagacctcccaaaataagtatggagcgaaagggtgtcagtagtgtaacaaatattgagcaaagaacagataaggtttccattcagaagaggcaactcactggtcagcagcaagataaatacaagtgttcagatgaagttgcagtgcaagtgaagcttgaagccacaaaaaggaaactccaggagagttatcaacaagctgagaatgccaagaagcaacggacagtacagggcacatgggcggagattatgagcaaggaagaagttgatccattgggtcagagttgggattcatacaaaacgacaaaagcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Med26

Protein Analysis

464

Amino Acids

52.29

Weight (kDa)

5.19

Isoelectric Point (pI)

37.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med26 PF08711 177 - 226 2.5e-13 TFIIS helical bundle-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 174
Acc36I ACCTGC 1 cut(s) 174
AccB1I GGYRCC 1 cut(s) 217
AccIII TCCGGA 1 cut(s) 54
AciI CCGC 3 cut(s) 108, 139, 1322
AclWI GGATC 5 cut(s) 153, 482, 628, 740, 1343
AcoI YGGCCR 1 cut(s) 12
AcsI RAATTY 1 cut(s) 64
AfaI GTAC 1 cut(s) 1308
AfiI CCNNNNNNNGG 2 cut(s) 21, 1251
AgsI TTSAA 3 cut(s) 440, 770, 1241
AjnI CCWGG 3 cut(s) 220, 899, 1260
AluBI AGCT 8 cut(s) 160, 405, 541, 704, 806, 1237, 1280, 1391
AluI AGCT 8 cut(s) 160, 405, 541, 704, 806, 1237, 1280, 1391
Alw21I GWGCWC 2 cut(s) 162, 229
Alw26I GTCTC 3 cut(s) 453, 560, 1078
AlwI GGATC 5 cut(s) 153, 482, 628, 740, 1343
Aor13HI TCCGGA 1 cut(s) 54
AoxI GGCC 4 cut(s) 12, 312, 1055, 1075
ApeKI GCWGC 2 cut(s) 345, 1189
ApoI RAATTY 1 cut(s) 64
Asp700I GAANNNNTTC 2 cut(s) 50, 777
AspS9I GGNCC 2 cut(s) 1056, 1076
AsuC2I CCSGG 1 cut(s) 316
AsuHPI GGTGA 3 cut(s) 308, 377, 1036
AsuII TTCGAA 1 cut(s) 646
BaeGI GKGCMC 1 cut(s) 1316
BanI GGYRCC 1 cut(s) 217
BanII GRGCYC 1 cut(s) 162
BbsI GAAGAC 1 cut(s) 18
Bbv12I GWGCWC 2 cut(s) 162, 229
BbvCI CCTCAGC 1 cut(s) 417
BbvI GCAGC 2 cut(s) 357, 1201
BccI CCATC 7 cut(s) 104, 544, 653, 757, 848, 934, 1015
BceAI ACGGC 2 cut(s) 27, 75
BciT130I CCWGG 3 cut(s) 222, 901, 1262
BclI TGATCA 4 cut(s) 247, 355, 385, 976
BcnI CCSGG 1 cut(s) 316
BcoDI GTCTC 3 cut(s) 453, 560, 1078
BfaI CTAG 1 cut(s) 321
BfmI CTRYAG 2 cut(s) 172, 699
BfuAI ACCTGC 1 cut(s) 174
BglI GCCNNNNNGGC 1 cut(s) 1054
BglII AGATCT 1 cut(s) 483
BisI GCNGC 3 cut(s) 108, 346, 1190
BlpI GCTNAGC 1 cut(s) 156
BlsI GCNGC 3 cut(s) 109, 347, 1191
Bme1390I CCNGG 4 cut(s) 222, 316, 901, 1262
BmgT120I GGNCC 2 cut(s) 1056, 1076
BmiI GGNNCC 1 cut(s) 219
BmrFI CCNGG 4 cut(s) 222, 316, 901, 1262
BmsI GCATC 2 cut(s) 90, 502
BpiI GAAGAC 1 cut(s) 18
BpmI CTGGAG 3 cut(s) 61, 953, 1244
Bpu10I CCTNAGC 1 cut(s) 417
Bpu1102I GCTNAGC 1 cut(s) 156
Bpu14I TTCGAA 1 cut(s) 646
BpuEI CTTGAG 2 cut(s) 557, 563
BpuMI CCSGG 1 cut(s) 316
BsaI GGTCTC 1 cut(s) 1078
BsaJI CCNNGG 5 cut(s) 9, 123, 289, 315, 1079
BsaWI WCCGGW 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 119, 149
Bsc4I CCNNNNNNNGG 2 cut(s) 21, 1251
Bse118I RCCGGY 1 cut(s) 603
Bse1I ACTGG 4 cut(s) 44, 936, 1016, 1186
BseAI TCCGGA 1 cut(s) 54
BseBI CCWGG 3 cut(s) 222, 901, 1262
BseDI CCNNGG 5 cut(s) 9, 123, 289, 315, 1079
BseGI GGATG 1 cut(s) 802
BseLI CCNNNNNNNGG 2 cut(s) 21, 1251
BseMII CTCAG 6 cut(s) 147, 408, 464, 573, 834, 1272
BseNI ACTGG 4 cut(s) 44, 936, 1016, 1186
BseRI GAGGAG 2 cut(s) 306, 777
BseSI GKGCMC 1 cut(s) 1316
BseXI GCAGC 2 cut(s) 357, 1201
BshFI GGCC 4 cut(s) 14, 314, 1057, 1077
BshNI GGYRCC 1 cut(s) 217
BsiHKAI GWGCWC 2 cut(s) 162, 229
BsiSI CCGG 3 cut(s) 55, 315, 604
BslFI GGGAC 1 cut(s) 105
BslI CCNNNNNNNGG 2 cut(s) 21, 1251
BsmAI GTCTC 3 cut(s) 453, 560, 1078
BsmFI GGGAC 1 cut(s) 105
BsmI GAATGC 1 cut(s) 1291
BsnI GGCC 4 cut(s) 14, 314, 1057, 1077
Bso31I GGTCTC 1 cut(s) 1078
Bsp119I TTCGAA 1 cut(s) 646
Bsp1286I GDGCHC 3 cut(s) 162, 229, 1316
Bsp13I TCCGGA 1 cut(s) 54
Bsp1720I GCTNAGC 1 cut(s) 156
BspACI CCGC 3 cut(s) 108, 139, 1322
BspANI GGCC 4 cut(s) 14, 314, 1057, 1077
BspCNI CTCAG 6 cut(s) 148, 409, 463, 574, 835, 1273
BspEI TCCGGA 1 cut(s) 54
BspHI TCATGA 1 cut(s) 241
BspLI GGNNCC 1 cut(s) 219
BspMAI CTGCAG 1 cut(s) 176
BspMI ACCTGC 1 cut(s) 174
BspPI GGATC 5 cut(s) 153, 482, 628, 740, 1343
BspT104I TTCGAA 1 cut(s) 646
BspT107I GGYRCC 1 cut(s) 217
BspTNI GGTCTC 1 cut(s) 1078
BsrFI RCCGGY 1 cut(s) 603
BsrI ACTGG 4 cut(s) 44, 936, 1016, 1186
BssAI RCCGGY 1 cut(s) 603
BssECI CCNNGG 5 cut(s) 9, 123, 289, 315, 1079
BssT1I CCWWGG 1 cut(s) 123
Bst2UI CCWGG 3 cut(s) 222, 901, 1262
Bst4CI ACNGT 3 cut(s) 887, 966, 1306
Bst6I CTCTTC 1 cut(s) 1163
BstBI TTCGAA 1 cut(s) 646
BstDEI CTNAG 7 cut(s) 156, 417, 450, 582, 608, 843, 1281
BstDSI CCRYGG 1 cut(s) 9
BstF5I GGATG 1 cut(s) 802
BstMAI GTCTC 3 cut(s) 453, 560, 1078
BstMWI GCNNNNNNNGC 9 cut(s) 11, 180, 402, 613, 701, 812, 1054, 1234, 1286
BstNI CCWGG 3 cut(s) 222, 901, 1262
BstSCI CCNGG 4 cut(s) 220, 314, 899, 1260
BstSFI CTRYAG 2 cut(s) 172, 699
BstSLI GKGCMC 1 cut(s) 1316
BstV1I GCAGC 2 cut(s) 357, 1201
BstV2I GAAGAC 1 cut(s) 18
BstX2I RGATCY 1 cut(s) 483
BstXI CCANNNNNNTGG 1 cut(s) 832
BstYI RGATCY 1 cut(s) 483
BsuRI GGCC 4 cut(s) 14, 314, 1057, 1077
BtgI CCRYGG 1 cut(s) 9
BtsCI GGATG 1 cut(s) 802
BtsI GCAGTG 1 cut(s) 1230
BtsIMutI CAGTG 6 cut(s) 29, 892, 929, 1023, 1179, 1230
BveI ACCTGC 1 cut(s) 174
CciI TCATGA 1 cut(s) 241
Cfr10I RCCGGY 1 cut(s) 603
Cfr13I GGNCC 2 cut(s) 1056, 1076
Csp6I GTAC 1 cut(s) 1307
CviQI GTAC 1 cut(s) 1307
DdeI CTNAG 7 cut(s) 156, 417, 450, 582, 608, 843, 1281
EaeI YGGCCR 1 cut(s) 12
Eam1104I CTCTTC 1 cut(s) 1163
EarI CTCTTC 1 cut(s) 1163
EciI GGCGGA 1 cut(s) 1337
Ecl136II GAGCTC 1 cut(s) 160
Eco130I CCWWGG 1 cut(s) 123
Eco24I GRGCYC 1 cut(s) 162
Eco31I GGTCTC 1 cut(s) 1078
Eco53kI GAGCTC 1 cut(s) 160
EcoICRI GAGCTC 1 cut(s) 160
EcoO109I RGGNCCY 1 cut(s) 1056
EcoRI GAATTC 1 cut(s) 64
EcoRII CCWGG 3 cut(s) 220, 899, 1260
EcoT14I CCWWGG 1 cut(s) 123
EcoT38I GRGCYC 1 cut(s) 162
ErhI CCWWGG 1 cut(s) 123
FalI AAGNNNNNCTT 4 cut(s) 762, 794, 1221, 1253
FaqI GGGAC 1 cut(s) 105
FbaI TGATCA 4 cut(s) 247, 355, 385, 976
Fnu4HI GCNGC 3 cut(s) 108, 346, 1190
FokI GGATG 1 cut(s) 809
FriOI GRGCYC 1 cut(s) 162
Fsp4HI GCNGC 3 cut(s) 108, 346, 1190
FspBI CTAG 1 cut(s) 321
GluI GCNGC 3 cut(s) 108, 346, 1190
GsuI CTGGAG 3 cut(s) 61, 953, 1244
HaeIII GGCC 4 cut(s) 14, 314, 1057, 1077
HapII CCGG 3 cut(s) 55, 315, 604
HincII GTYRAC 1 cut(s) 601
HindII GTYRAC 1 cut(s) 601
HindIII AAGCTT 3 cut(s) 539, 1235, 1389
HinfI GANTC 9 cut(s) 446, 506, 527, 568, 631, 737, 874, 904, 1370
HpaI GTTAAC 1 cut(s) 601
HpaII CCGG 3 cut(s) 55, 315, 604
HphI GGTGA 3 cut(s) 308, 377, 1036
Hpy166II GTNNAC 3 cut(s) 500, 601, 1013
Hpy188I TCNGA 9 cut(s) 70, 360, 511, 736, 844, 1083, 1167, 1213, 1362
Hpy188III TCNNGA 5 cut(s) 55, 242, 389, 490, 908
Hpy8I GTNNAC 3 cut(s) 500, 601, 1013
HpyAV CCTTC 3 cut(s) 586, 767, 794
HpyCH4III ACNGT 3 cut(s) 887, 966, 1306
HpyCH4V TGCA 3 cut(s) 174, 1223, 1228
HpyF10VI GCNNNNNNNGC 9 cut(s) 11, 180, 402, 613, 701, 812, 1054, 1234, 1286
HpyF3I CTNAG 7 cut(s) 156, 417, 450, 582, 608, 843, 1281
Kpn2I TCCGGA 1 cut(s) 54
Ksp22I TGATCA 4 cut(s) 247, 355, 385, 976
KspAI GTTAAC 1 cut(s) 601
LmnI GCTCC 3 cut(s) 262, 803, 1105
Lsp1109I GCAGC 2 cut(s) 357, 1201
LweI GCATC 2 cut(s) 90, 502
MaeI CTAG 1 cut(s) 321
MaeIII GTNAC 1 cut(s) 1126
MboII GAAGA 9 cut(s) 18, 391, 478, 640, 782, 875, 930, 1180, 1352
MfeI CAATTG 1 cut(s) 753
MflI RGATCY 1 cut(s) 483
MhlI GDGCHC 3 cut(s) 162, 229, 1316
MluCI AATT 6 cut(s) 34, 46, 64, 397, 654, 753
MlyI GAGTC 4 cut(s) 455, 515, 536, 562
MmeI TCCRAC 1 cut(s) 93
MroI TCCGGA 1 cut(s) 54
MroXI GAANNNNTTC 2 cut(s) 50, 777
MseI TTAA 1 cut(s) 600
MslI CAYNNNNRTG 4 cut(s) 234, 240, 270, 830
MspA1I CMGCKG 1 cut(s) 110
MspI CCGG 3 cut(s) 55, 315, 604
MspR9I CCNGG 4 cut(s) 222, 316, 901, 1262
MunI CAATTG 1 cut(s) 753
Mva1269I GAATGC 1 cut(s) 1291
MvaI CCWGG 3 cut(s) 222, 901, 1262
MwoI GCNNNNNNNGC 9 cut(s) 11, 180, 402, 613, 701, 812, 1054, 1234, 1286
NciI CCSGG 1 cut(s) 316
NlaIV GGNNCC 1 cut(s) 219
NspV TTCGAA 1 cut(s) 646
PagI TCATGA 1 cut(s) 241
PaqCI CACCTGC 1 cut(s) 174
PctI GAATGC 1 cut(s) 1291
PdmI GAANNNNTTC 2 cut(s) 50, 777
PfeI GAWTC 5 cut(s) 631, 737, 874, 904, 1370
PfoI TCCNGGA 1 cut(s) 1260
PkrI GCNGC 3 cut(s) 109, 347, 1191
PleI GAGTC 4 cut(s) 454, 514, 535, 562
PpsI GAGTC 4 cut(s) 454, 514, 535, 562
Psp124BI GAGCTC 1 cut(s) 162
Psp6I CCWGG 3 cut(s) 220, 899, 1260
PspGI CCWGG 3 cut(s) 220, 899, 1260
PspN4I GGNNCC 1 cut(s) 219
PspPI GGNCC 2 cut(s) 1056, 1076
PstI CTGCAG 1 cut(s) 176
PsuI RGATCY 1 cut(s) 483
RsaI GTAC 1 cut(s) 1308
RsaNI GTAC 1 cut(s) 1307
RseI CAYNNNNRTG 4 cut(s) 234, 240, 270, 830
SacI GAGCTC 1 cut(s) 162
SaqAI TTAA 1 cut(s) 600
SatI GCNGC 3 cut(s) 108, 346, 1190
Sau96I GGNCC 2 cut(s) 1056, 1076
SchI GAGTC 4 cut(s) 455, 515, 536, 562
ScrFI CCNGG 4 cut(s) 222, 316, 901, 1262
SduI GDGCHC 3 cut(s) 162, 229, 1316
SfaNI GCATC 2 cut(s) 90, 502
SfcI CTRYAG 2 cut(s) 172, 699
SfuI TTCGAA 1 cut(s) 646
SmiMI CAYNNNNRTG 4 cut(s) 234, 240, 270, 830
SmlI CTYRAG 2 cut(s) 542, 572
SmoI CTYRAG 2 cut(s) 542, 572
Sse9I AATT 6 cut(s) 34, 46, 64, 397, 654, 753
SsiI CCGC 3 cut(s) 108, 139, 1322
SspI AATATT 1 cut(s) 1135
SspMI CTAG 1 cut(s) 321
SstI GAGCTC 1 cut(s) 162
StyD4I CCNGG 4 cut(s) 220, 314, 899, 1260
StyI CCWWGG 1 cut(s) 123
TaaI ACNGT 3 cut(s) 887, 966, 1306
TaqI TCGA 3 cut(s) 148, 646, 880
TaqII GACCGA 2 cut(s) 303, 443
TasI AATT 6 cut(s) 34, 46, 64, 397, 654, 753
TatI WGTACW 1 cut(s) 1306
TauI GCSGC 1 cut(s) 110
TfiI GAWTC 5 cut(s) 631, 737, 874, 904, 1370
Tru1I TTAA 1 cut(s) 600
Tru9I TTAA 1 cut(s) 600
TscAI CASTG 6 cut(s) 36, 892, 936, 1023, 1186, 1230
TseI GCWGC 2 cut(s) 345, 1189
TspDTI ATGAA 6 cut(s) 392, 641, 696, 813, 1230, 1362
TspGWI ACGGA 1 cut(s) 1315
TspRI CASTG 6 cut(s) 36, 892, 936, 1023, 1186, 1230
XapI RAATTY 1 cut(s) 64
XcmI CCANNNNNNNNNTGG 2 cut(s) 790, 1099
XmnI GAANNNNTTC 2 cut(s) 50, 777
XspI CTAG 1 cut(s) 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.