Rroxscaffold_1G00024610

DEAD-box ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
30588183 .. 30592684
4502 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00024610.1

Sequence Viewer

Length: 198 bp
ATGGCGACTAGTAGTAGCGGCGGCGGTGTTTTGTTGGCCTTTCTGGAAAGGCAGAGAGCTAACTTCAACAATGTTTTGAGAGAGATGAGTATTTTCGCTACTCAGGCAATTGTAACGCCCAATTTTGTGCTCAGTGAAGAGGCCTTCAAAGGGCTAGGGGAGTTTTTGAAGGTGGAACTGGACTCGGAGTTGGAGTAG

Protein Analysis

65

Amino Acids

7.12

Weight (kDa)

4.62

Isoelectric Point (pI)

32.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 18, 21, 24
AfiI CCNNNNNNNGG 1 cut(s) 150
AgsI TTSAA 3 cut(s) 67, 148, 169
AhlI ACTAGT 1 cut(s) 8
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw21I GWGCWC 1 cut(s) 132
AoxI GGCC 2 cut(s) 36, 141
Bbv12I GWGCWC 1 cut(s) 132
BcuI ACTAGT 1 cut(s) 8
BfaI CTAG 2 cut(s) 9, 155
BisI GCNGC 2 cut(s) 19, 22
BlsI GCNGC 2 cut(s) 20, 23
BsaXI ACNNNNNCTCC 1 cut(s) 179
Bsc4I CCNNNNNNNGG 1 cut(s) 150
Bse1I ACTGG 1 cut(s) 183
BseLI CCNNNNNNNGG 1 cut(s) 150
BseMII CTCAG 2 cut(s) 116, 145
BseNI ACTGG 1 cut(s) 183
BshFI GGCC 2 cut(s) 38, 143
BsiHKAI GWGCWC 1 cut(s) 132
BslI CCNNNNNNNGG 1 cut(s) 150
BsnI GGCC 2 cut(s) 38, 143
Bsp1286I GDGCHC 1 cut(s) 132
BspACI CCGC 3 cut(s) 18, 21, 24
BspANI GGCC 2 cut(s) 38, 143
BspCNI CTCAG 2 cut(s) 115, 144
BsrI ACTGG 1 cut(s) 183
Bst6I CTCTTC 1 cut(s) 132
BstDEI CTNAG 2 cut(s) 102, 131
BstMWI GCNNNNNNNGC 1 cut(s) 104
BsuRI GGCC 2 cut(s) 38, 143
BtsIMutI CAGTG 1 cut(s) 139
CviJI RGCY 4 cut(s) 38, 59, 143, 154
CviKI_1 RGCY 4 cut(s) 38, 59, 143, 154
DdeI CTNAG 2 cut(s) 102, 131
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
Eco147I AGGCCT 1 cut(s) 143
Fnu4HI GCNGC 2 cut(s) 19, 22
Fsp4HI GCNGC 2 cut(s) 19, 22
FspBI CTAG 2 cut(s) 9, 155
GluI GCNGC 2 cut(s) 19, 22
HaeIII GGCC 2 cut(s) 38, 143
HinfI GANTC 1 cut(s) 182
Hpy188I TCNGA 1 cut(s) 187
Hpy188III TCNNGA 1 cut(s) 44
HpyAV CCTTC 2 cut(s) 154, 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpyF3I CTNAG 2 cut(s) 102, 131
LpnPI CCDG 3 cut(s) 29, 89, 164
MaeI CTAG 2 cut(s) 9, 155
MaeIII GTNAC 1 cut(s) 112
MboII GAAGA 1 cut(s) 149
MfeI CAATTG 1 cut(s) 108
MhlI GDGCHC 1 cut(s) 132
MluCI AATT 2 cut(s) 108, 121
MlyI GAGTC 1 cut(s) 176
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 1 cut(s) 133
MunI CAATTG 1 cut(s) 108
MwoI GCNNNNNNNGC 1 cut(s) 104
PceI AGGCCT 1 cut(s) 143
PkrI GCNGC 2 cut(s) 20, 23
PleI GAGTC 1 cut(s) 176
PpsI GAGTC 1 cut(s) 176
SatI GCNGC 2 cut(s) 19, 22
SchI GAGTC 1 cut(s) 176
SduI GDGCHC 1 cut(s) 132
SetI ASST 2 cut(s) 61, 174
SgeI CNNG 5 cut(s) 21, 56, 116, 167, 191
SpeI ACTAGT 1 cut(s) 8
Sse9I AATT 2 cut(s) 108, 121
SseBI AGGCCT 1 cut(s) 143
SsiI CCGC 3 cut(s) 18, 21, 24
SspMI CTAG 2 cut(s) 9, 155
StuI AGGCCT 1 cut(s) 143
TasI AATT 2 cut(s) 108, 121
TauI GCSGC 2 cut(s) 21, 24
TscAI CASTG 1 cut(s) 139
TspRI CASTG 1 cut(s) 139
XspI CTAG 2 cut(s) 9, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.