Rroxscaffold_2G00087840

Late embryogenesis abundant protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
9915079 .. 9915828
750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00087840.1

Sequence Viewer

Length: 750 bp
ATGCACCCAGGGCCTTACAACCCGCCACCAGGAGCCTACCCACCTCCTGGACCCTATGGCCGTAACGTTCCTCGTTATGGCCATCCTGGAGCAGGCAGTCGTAGAGGTGGCTGCAGTTGCTTAAAGGTGTATTGTTGTTGCTGCTGCTGCTTGTTCATAACCCTAGTGCTGATTATCGGTGGCATCGTTCTTGCCTACTTTATAATCAAGCCTCACACACCCAAATTCAGCATCGATAAATTTGAAGTCAAATCCTTCAACATTAGCGACGATTTCAGCCTCAAGTCACACCTTGAGATCACTGCAAAAGCTGACAATCCCAACAAGTACATCGAAATCACATACGGAGAAGGAAAGGAGCCGAAGGACAACTCGGTCCAAGTCTCGTACTCAAATGTCACGCTTTGTTCCGGGACCATCCCAAATATCTTTCAACCCAAAAAAAACGTGACAATGATTAAAATCGATCTCAAAGGGGACTTGAAAAAAGAAGATTGGGCAGCAGGCTCCGGTGAATCACTTGCATCGAAATTGAAGAACAACGACAAGATCCCTTTGCTTGTTGCAATAAAAGCACCAGTTAAGGTAAAGCTTGGAAGTTGGTGGGTAACGAAGGATGAGCCGTTGGTTGTTAGTATCAACGCCACCATGAACGTCAAGAATCTTGCTGAAGGCAAGAACCCAGAGATTTCAGACAAAAAATATTCTATAGGTCTTTTATTCGGCAAGATTTATACTAAGCTTTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

249

Amino Acids

27.27

Weight (kDa)

9.2

Isoelectric Point (pI)

21.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 203
AasI GACNNNNNNGTC 1 cut(s) 374
AccB7I CCANNNNNTGG 1 cut(s) 47
AciI CCGC 1 cut(s) 23
AclI AACGTT 1 cut(s) 66
AclWI GGATC 1 cut(s) 544
AcoI YGGCCR 2 cut(s) 58, 79
AcsI RAATTY 2 cut(s) 224, 239
AcuI CTGAAG 1 cut(s) 690
AfaI GTAC 2 cut(s) 329, 389
AfiI CCNNNNNNNGG 4 cut(s) 29, 47, 77, 92
AgsI TTSAA 5 cut(s) 245, 259, 434, 484, 535
AjnI CCWGG 4 cut(s) 7, 28, 46, 85
AluBI AGCT 3 cut(s) 311, 592, 742
AluI AGCT 3 cut(s) 311, 592, 742
Alw26I GTCTC 1 cut(s) 388
AlwI GGATC 1 cut(s) 544
AoxI GGCC 3 cut(s) 11, 58, 79
ApeKI GCWGC 5 cut(s) 111, 141, 144, 147, 500
ApoI RAATTY 2 cut(s) 224, 239
AspS9I GGNCC 4 cut(s) 11, 50, 376, 414
AsuC2I CCSGG 1 cut(s) 412
AsuHPI GGTGA 1 cut(s) 524
AvaII GGWCC 3 cut(s) 50, 376, 414
BalI TGGCCA 1 cut(s) 81
BbvI GCAGC 5 cut(s) 98, 128, 131, 134, 512
BccI CCATC 2 cut(s) 90, 425
BceAI ACGGC 2 cut(s) 45, 607
BciT130I CCWGG 4 cut(s) 9, 30, 48, 87
BcnI CCSGG 1 cut(s) 412
BcoDI GTCTC 1 cut(s) 388
BfaI CTAG 1 cut(s) 164
BfmI CTRYAG 2 cut(s) 112, 708
BisI GCNGC 5 cut(s) 112, 142, 145, 148, 501
BlsI GCNGC 5 cut(s) 113, 143, 146, 149, 502
Bme1390I CCNGG 5 cut(s) 9, 30, 48, 87, 412
Bme18I GGWCC 3 cut(s) 50, 376, 414
BmgT120I GGNCC 4 cut(s) 11, 50, 376, 414
BmiI GGNNCC 5 cut(s) 34, 52, 360, 415, 508
BmrFI CCNGG 5 cut(s) 9, 30, 48, 87, 412
BmsI GCATC 3 cut(s) 192, 240, 533
BpmI CTGGAG 1 cut(s) 108
BpuEI CTTGAG 2 cut(s) 266, 314
BpuMI CCSGG 1 cut(s) 412
Bsa29I ATCGAT 2 cut(s) 234, 465
BsaBI GATNNNNATC 1 cut(s) 461
BsaJI CCNNGG 2 cut(s) 7, 8
BsaWI WCCGGW 1 cut(s) 509
Bsc4I CCNNNNNNNGG 4 cut(s) 29, 47, 77, 92
Bse1I ACTGG 1 cut(s) 578
Bse8I GATNNNNATC 1 cut(s) 461
BseBI CCWGG 4 cut(s) 9, 30, 48, 87
BseCI ATCGAT 2 cut(s) 234, 465
BseDI CCNNGG 2 cut(s) 7, 8
BseGI GGATG 3 cut(s) 82, 417, 622
BseJI GATNNNNATC 1 cut(s) 461
BseLI CCNNNNNNNGG 4 cut(s) 29, 47, 77, 92
BseNI ACTGG 1 cut(s) 578
BseXI GCAGC 5 cut(s) 98, 128, 131, 134, 512
BshFI GGCC 3 cut(s) 13, 60, 81
BshVI ATCGAT 2 cut(s) 234, 465
BsiSI CCGG 2 cut(s) 411, 510
BslFI GGGAC 2 cut(s) 427, 491
BslI CCNNNNNNNGG 4 cut(s) 29, 47, 77, 92
BsmAI GTCTC 1 cut(s) 388
BsmFI GGGAC 2 cut(s) 427, 491
BsnI GGCC 3 cut(s) 13, 60, 81
Bsp143I GATC 3 cut(s) 297, 466, 549
BspACI CCGC 1 cut(s) 23
BspANI GGCC 3 cut(s) 13, 60, 81
BspDI ATCGAT 2 cut(s) 234, 465
BspLI GGNNCC 5 cut(s) 34, 52, 360, 415, 508
BspMAI CTGCAG 1 cut(s) 116
BspPI GGATC 1 cut(s) 544
BsrI ACTGG 1 cut(s) 578
BssECI CCNNGG 2 cut(s) 7, 8
BssMI GATC 3 cut(s) 297, 466, 549
Bst2UI CCWGG 4 cut(s) 9, 30, 48, 87
BstC8I GCNNGC 2 cut(s) 94, 505
BstDEI CTNAG 1 cut(s) 738
BstENI CCTNNNNNAGG 1 cut(s) 90
BstF5I GGATG 3 cut(s) 82, 417, 622
BstKTI GATC 3 cut(s) 300, 469, 552
BstMAI GTCTC 1 cut(s) 388
BstMBI GATC 3 cut(s) 297, 466, 549
BstMWI GCNNNNNNNGC 4 cut(s) 10, 117, 147, 572
BstNI CCWGG 4 cut(s) 9, 30, 48, 87
BstSCI CCNGG 5 cut(s) 7, 28, 46, 85, 410
BstSFI CTRYAG 2 cut(s) 112, 708
BstV1I GCAGC 5 cut(s) 98, 128, 131, 134, 512
BstX2I RGATCY 1 cut(s) 549
BstYI RGATCY 1 cut(s) 549
Bsu15I ATCGAT 2 cut(s) 234, 465
BsuRI GGCC 3 cut(s) 13, 60, 81
BsuTUI ATCGAT 2 cut(s) 234, 465
BtsCI GGATG 3 cut(s) 82, 417, 622
BtsI GCAGTG 1 cut(s) 300
BtsIMutI CAGTG 1 cut(s) 300
Cac8I GCNNGC 2 cut(s) 94, 505
Cfr13I GGNCC 4 cut(s) 11, 50, 376, 414
ClaI ATCGAT 2 cut(s) 234, 465
Csp6I GTAC 2 cut(s) 328, 388
CviAII CATG 1 cut(s) 649
CviQI GTAC 2 cut(s) 328, 388
DdeI CTNAG 1 cut(s) 738
DpnI GATC 3 cut(s) 299, 468, 551
DpnII GATC 3 cut(s) 297, 466, 549
DrdI GACNNNNNNGTC 1 cut(s) 374
DseDI GACNNNNNNGTC 1 cut(s) 374
EaeI YGGCCR 2 cut(s) 58, 79
Eco47I GGWCC 3 cut(s) 50, 376, 414
Eco57I CTGAAG 1 cut(s) 690
EcoNI CCTNNNNNAGG 1 cut(s) 90
EcoO109I RGGNCCY 1 cut(s) 11
EcoRII CCWGG 4 cut(s) 7, 28, 46, 85
FaeI CATG 1 cut(s) 652
FaiI YATR 8 cut(s) 57, 78, 158, 203, 343, 650, 710, 735
FaqI GGGAC 2 cut(s) 427, 491
FatI CATG 1 cut(s) 648
FauI CCCGC 1 cut(s) 30
Fnu4HI GCNGC 5 cut(s) 112, 142, 145, 148, 501
FokI GGATG 3 cut(s) 69, 404, 629
Fsp4HI GCNGC 5 cut(s) 112, 142, 145, 148, 501
FspBI CTAG 1 cut(s) 164
GluI GCNGC 5 cut(s) 112, 142, 145, 148, 501
GsuI CTGGAG 1 cut(s) 108
HaeIII GGCC 3 cut(s) 13, 60, 81
HapII CCGG 2 cut(s) 411, 510
Hin1II CATG 1 cut(s) 652
HindIII AAGCTT 2 cut(s) 590, 740
HinfI GANTC 2 cut(s) 515, 661
HpaII CCGG 2 cut(s) 411, 510
HphI GGTGA 1 cut(s) 524
Hpy188I TCNGA 1 cut(s) 694
Hpy188III TCNNGA 1 cut(s) 658
Hpy99I CGWCG 1 cut(s) 272
HpyAV CCTTC 5 cut(s) 265, 344, 358, 607, 665
HpyCH4IV ACGT 3 cut(s) 66, 447, 654
HpyCH4V TGCA 5 cut(s) 4, 114, 305, 524, 566
HpyF10VI GCNNNNNNNGC 4 cut(s) 10, 117, 147, 572
HpyF3I CTNAG 1 cut(s) 738
HpySE526I ACGT 3 cut(s) 66, 447, 654
Hsp92II CATG 1 cut(s) 652
Kzo9I GATC 3 cut(s) 297, 466, 549
LmnI GCTCC 4 cut(s) 32, 89, 358, 512
Lsp1109I GCAGC 5 cut(s) 98, 128, 131, 134, 512
LweI GCATC 3 cut(s) 192, 240, 533
MaeI CTAG 1 cut(s) 164
MaeII ACGT 3 cut(s) 66, 447, 654
MaeIII GTNAC 5 cut(s) 62, 285, 397, 448, 607
MalI GATC 3 cut(s) 299, 468, 551
MboI GATC 3 cut(s) 297, 466, 549
MboII GAAGA 2 cut(s) 503, 547
MflI RGATCY 1 cut(s) 549
MlsI TGGCCA 1 cut(s) 81
MluCI AATT 3 cut(s) 224, 239, 530
MluNI TGGCCA 1 cut(s) 81
MnlI CCTC 5 cut(s) 54, 81, 98, 222, 290
Mox20I TGGCCA 1 cut(s) 81
MscI TGGCCA 1 cut(s) 81
MseI TTAA 3 cut(s) 122, 459, 582
Msp20I TGGCCA 1 cut(s) 81
MspI CCGG 2 cut(s) 411, 510
MspR9I CCNGG 5 cut(s) 9, 30, 48, 87, 412
MvaI CCWGG 4 cut(s) 9, 30, 48, 87
MwoI GCNNNNNNNGC 4 cut(s) 10, 117, 147, 572
NciI CCSGG 1 cut(s) 412
NdeII GATC 3 cut(s) 297, 466, 549
NlaIII CATG 1 cut(s) 652
NlaIV GGNNCC 5 cut(s) 34, 52, 360, 415, 508
NmuCI GTSAC 3 cut(s) 285, 397, 448
PasI CCCWGGG 1 cut(s) 8
PcsI WCGNNNNNNNCGW 1 cut(s) 183
PfeI GAWTC 2 cut(s) 515, 661
PflMI CCANNNNNTGG 1 cut(s) 47
PfoI TCCNGGA 3 cut(s) 46, 85, 410
PkrI GCNGC 5 cut(s) 113, 143, 146, 149, 502
PsiI TTATAA 1 cut(s) 203
Psp1406I AACGTT 1 cut(s) 66
Psp6I CCWGG 4 cut(s) 7, 28, 46, 85
PspGI CCWGG 4 cut(s) 7, 28, 46, 85
PspN4I GGNNCC 5 cut(s) 34, 52, 360, 415, 508
PspPI GGNCC 4 cut(s) 11, 50, 376, 414
PstI CTGCAG 1 cut(s) 116
PsuI RGATCY 1 cut(s) 549
RsaI GTAC 2 cut(s) 329, 389
RsaNI GTAC 2 cut(s) 328, 388
SaqAI TTAA 3 cut(s) 122, 459, 582
SatI GCNGC 5 cut(s) 112, 142, 145, 148, 501
Sau3AI GATC 3 cut(s) 297, 466, 549
Sau96I GGNCC 4 cut(s) 11, 50, 376, 414
ScrFI CCNGG 5 cut(s) 9, 30, 48, 87, 412
SfaNI GCATC 3 cut(s) 192, 240, 533
SfcI CTRYAG 2 cut(s) 112, 708
SinI GGWCC 3 cut(s) 50, 376, 414
SmlI CTYRAG 2 cut(s) 281, 293
SmoI CTYRAG 2 cut(s) 281, 293
Sse9I AATT 3 cut(s) 224, 239, 530
SsiI CCGC 1 cut(s) 23
SspI AATATT 1 cut(s) 704
SspMI CTAG 1 cut(s) 164
StyD4I CCNGG 5 cut(s) 7, 28, 46, 85, 410
TaiI ACGT 3 cut(s) 69, 450, 657
TaqI TCGA 4 cut(s) 234, 333, 465, 527
TaqII GACCGA 1 cut(s) 364
TasI AATT 3 cut(s) 224, 239, 530
TatI WGTACW 1 cut(s) 327
TfiI GAWTC 2 cut(s) 515, 661
Tru1I TTAA 3 cut(s) 122, 459, 582
Tru9I TTAA 3 cut(s) 122, 459, 582
TscAI CASTG 1 cut(s) 307
TseFI GTSAC 3 cut(s) 285, 397, 448
TseI GCWGC 5 cut(s) 111, 141, 144, 147, 500
Tsp45I GTSAC 3 cut(s) 285, 397, 448
TspDTI ATGAA 2 cut(s) 145, 665
TspGWI ACGGA 1 cut(s) 360
TspRI CASTG 1 cut(s) 307
Van91I CCANNNNNTGG 1 cut(s) 47
VpaK11BI GGWCC 3 cut(s) 50, 376, 414
XagI CCTNNNNNAGG 1 cut(s) 90
XapI RAATTY 2 cut(s) 224, 239
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.