Rroxscaffold_2G00102750
MYB Family

cheY-homologous receiver domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
25015453 .. 25017521
2069 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00102750.1

Sequence Viewer

Length: 393 bp
ATGGTGGGGGCATATCAGACGTCTGAAGGCCTGGATGAGGAGGTAGATGGTGGTTGTCTTTTCAAAGGGGCTGTATATGATATTGTTAAGCTACTCACAATGGATAATCTCAAGAATCTTTGGCAATCTGCATTCAGAAACAACAGAAATGTGGTGATAGACATTACTAAAGAGGAAAGTAATGCTCATGTAGAATCACAAGCAAACATACCGATTTTCAAAATAGAAAGGTCAGAAGGAATGGACAATTTGGAGGAGAAATATAGCAGTGGTTCAACAGCCTTCACGAAGCGAAGGAGTGACAGGCAAGCTGATCATGAGCCAATAATATCATCATCGGAGACCAAAGAACCCAGCAAAGCAAAACTTAGCAAGGAAAAAAAAAATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

14.68

Weight (kDa)

5.48

Isoelectric Point (pI)

56.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014797)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 23
AcuI CTGAAG 1 cut(s) 45
AcyI GRCGYC 1 cut(s) 20
AfiI CCNNNNNNNGG 1 cut(s) 37
AgsI TTSAA 3 cut(s) 64, 220, 276
AjnI CCWGG 1 cut(s) 30
AluBI AGCT 2 cut(s) 91, 311
AluI AGCT 2 cut(s) 91, 311
Alw26I GTCTC 1 cut(s) 335
AoxI GGCC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 166
BccI CCATC 1 cut(s) 41
BciT130I CCWGG 1 cut(s) 32
BclI TGATCA 1 cut(s) 313
BcoDI GTCTC 1 cut(s) 335
Bme1390I CCNGG 1 cut(s) 32
BmrFI CCNGG 1 cut(s) 32
BpuEI CTTGAG 1 cut(s) 95
BsaHI GRCGYC 1 cut(s) 20
BsaI GGTCTC 1 cut(s) 335
Bsc4I CCNNNNNNNGG 1 cut(s) 37
BseBI CCWGG 1 cut(s) 32
BseGI GGATG 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 37
BseRI GAGGAG 2 cut(s) 53, 269
BseYI CCCAGC 1 cut(s) 353
BshFI GGCC 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 37
BsmAI GTCTC 1 cut(s) 335
BsmI GAATGC 1 cut(s) 131
BsnI GGCC 1 cut(s) 30
Bso31I GGTCTC 1 cut(s) 335
Bsp143I GATC 1 cut(s) 313
BspANI GGCC 1 cut(s) 30
BspHI TCATGA 1 cut(s) 316
BspTNI GGTCTC 1 cut(s) 335
BssMI GATC 1 cut(s) 313
BssNI GRCGYC 1 cut(s) 20
Bst2UI CCWGG 1 cut(s) 32
BstACI GRCGYC 1 cut(s) 20
BstC8I GCNNGC 1 cut(s) 309
BstDEI CTNAG 1 cut(s) 368
BstENI CCTNNNNNAGG 1 cut(s) 35
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 1 cut(s) 316
BstMAI GTCTC 1 cut(s) 335
BstMBI GATC 1 cut(s) 313
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BsuRI GGCC 1 cut(s) 30
BtsCI GGATG 1 cut(s) 40
BtsI GCAGTG 1 cut(s) 274
BtsIMutI CAGTG 1 cut(s) 274
Cac8I GCNNGC 1 cut(s) 309
CciI TCATGA 1 cut(s) 316
CviAII CATG 2 cut(s) 188, 317
CviJI RGCY 6 cut(s) 30, 71, 91, 281, 311, 322
CviKI_1 RGCY 6 cut(s) 30, 71, 91, 281, 311, 322
DdeI CTNAG 1 cut(s) 368
DpnI GATC 1 cut(s) 315
DpnII GATC 1 cut(s) 313
Eco147I AGGCCT 1 cut(s) 30
Eco31I GGTCTC 1 cut(s) 335
Eco57I CTGAAG 1 cut(s) 45
EcoNI CCTNNNNNAGG 1 cut(s) 35
EcoRII CCWGG 1 cut(s) 30
FaeI CATG 2 cut(s) 191, 320
FaiI YATR 7 cut(s) 13, 76, 78, 189, 209, 264, 318
FalI AAGNNNNNCTT 2 cut(s) 351, 383
FatI CATG 2 cut(s) 187, 316
FbaI TGATCA 1 cut(s) 313
FokI GGATG 1 cut(s) 47
GsaI CCCAGC 1 cut(s) 357
HaeIII GGCC 1 cut(s) 30
Hin1I GRCGYC 1 cut(s) 20
Hin1II CATG 2 cut(s) 191, 320
HinfI GANTC 2 cut(s) 115, 194
HphI GGTGA 1 cut(s) 166
Hpy188I TCNGA 5 cut(s) 18, 25, 137, 235, 340
Hpy188III TCNNGA 3 cut(s) 112, 286, 317
HpyAV CCTTC 4 cut(s) 20, 230, 288, 292
HpyCH4IV ACGT 1 cut(s) 20
HpyCH4V TGCA 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 368
HpySE526I ACGT 1 cut(s) 20
Hsp92I GRCGYC 1 cut(s) 20
Hsp92II CATG 2 cut(s) 191, 320
Ksp22I TGATCA 1 cut(s) 313
Kzo9I GATC 1 cut(s) 313
LpnPI CCDG 4 cut(s) 17, 44, 289, 367
MaeII ACGT 1 cut(s) 20
MaeIII GTNAC 1 cut(s) 299
MalI GATC 1 cut(s) 315
MboI GATC 1 cut(s) 313
MluCI AATT 2 cut(s) 247, 385
MnlI CCTC 4 cut(s) 31, 34, 166, 247
MseI TTAA 1 cut(s) 87
MspR9I CCNGG 1 cut(s) 32
Mva1269I GAATGC 1 cut(s) 131
MvaI CCWGG 1 cut(s) 32
NdeII GATC 1 cut(s) 313
NlaIII CATG 2 cut(s) 191, 320
NmuCI GTSAC 1 cut(s) 299
PagI TCATGA 1 cut(s) 316
PceI AGGCCT 1 cut(s) 30
PctI GAATGC 1 cut(s) 131
PfeI GAWTC 2 cut(s) 115, 194
Psp6I CCWGG 1 cut(s) 30
PspFI CCCAGC 1 cut(s) 353
PspGI CCWGG 1 cut(s) 30
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 1 cut(s) 313
ScrFI CCNGG 1 cut(s) 32
SetI ASST 5 cut(s) 23, 45, 93, 233, 313
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 2 cut(s) 247, 385
SseBI AGGCCT 1 cut(s) 30
StuI AGGCCT 1 cut(s) 30
StyD4I CCNGG 1 cut(s) 30
TaiI ACGT 1 cut(s) 23
TasI AATT 2 cut(s) 247, 385
TfiI GAWTC 2 cut(s) 115, 194
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TscAI CASTG 1 cut(s) 274
TseFI GTSAC 1 cut(s) 299
Tsp45I GTSAC 1 cut(s) 299
TspRI CASTG 1 cut(s) 274
XagI CCTNNNNNAGG 1 cut(s) 35
ZraI GACGTC 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.