Rroxscaffold_2G00151550

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0012556
Physical Location & Seq
Forward (+)
88776648 .. 88777078
431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00151550.1

Sequence Viewer

Length: 234 bp
ATGGATATTCGTTTCGGCGTCAACCTCTCCCCGGCAACCATGATGATTACGTTTCTAAGTGAACATAACTGGGATGGGCATGGATGCAATTCCGGTGAACATCCAGCCATCGGCCAAGTTGTCTGGCTTATGCCGGGGGCTCGCGTCAGAGTCACTCCTCAATCTGCCCCTGAAACTTCTGATCCTGATCGACCTGGGAACACCGAGGAACAAGTACTAGAAACAGGCTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.42

Weight (kDa)

4.66

Isoelectric Point (pI)

43.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 144
AclWI GGATC 1 cut(s) 176
AcoI YGGCCR 1 cut(s) 112
AcyI GRCGYC 1 cut(s) 18
AfaI GTAC 1 cut(s) 216
AfiI CCNNNNNNNGG 2 cut(s) 31, 110
AjnI CCWGG 1 cut(s) 193
AlwI GGATC 1 cut(s) 176
AoxI GGCC 1 cut(s) 112
AsuC2I CCSGG 2 cut(s) 32, 135
AsuHPI GGTGA 1 cut(s) 107
BanII GRGCYC 1 cut(s) 142
BccI CCATC 2 cut(s) 68, 116
BciT130I CCWGG 1 cut(s) 195
BcnI CCSGG 2 cut(s) 32, 135
BfaI CTAG 1 cut(s) 218
BmcAI AGTACT 1 cut(s) 216
Bme1390I CCNGG 3 cut(s) 32, 135, 195
BmrFI CCNGG 3 cut(s) 32, 135, 195
BmrI ACTGGG 1 cut(s) 79
BmsI GCATC 1 cut(s) 74
BmuI ACTGGG 1 cut(s) 79
BpuMI CCSGG 2 cut(s) 32, 135
BsaBI GATNNNNATC 1 cut(s) 186
BsaHI GRCGYC 1 cut(s) 18
BsaJI CCNNGG 4 cut(s) 30, 134, 194, 204
BsaWI WCCGGW 1 cut(s) 92
Bsc4I CCNNNNNNNGG 2 cut(s) 31, 110
Bse1I ACTGG 1 cut(s) 74
Bse8I GATNNNNATC 1 cut(s) 186
BseBI CCWGG 1 cut(s) 195
BseDI CCNNGG 4 cut(s) 30, 134, 194, 204
BseGI GGATG 3 cut(s) 79, 89, 100
BseJI GATNNNNATC 1 cut(s) 186
BseLI CCNNNNNNNGG 2 cut(s) 31, 110
BseNI ACTGG 1 cut(s) 74
BseRI GAGGAG 1 cut(s) 147
Bsh1236I CGCG 1 cut(s) 144
BshFI GGCC 1 cut(s) 114
BsiSI CCGG 3 cut(s) 32, 93, 134
BslI CCNNNNNNNGG 2 cut(s) 31, 110
BsnI GGCC 1 cut(s) 114
Bsp1286I GDGCHC 1 cut(s) 142
Bsp143I GATC 2 cut(s) 181, 187
BspANI GGCC 1 cut(s) 114
BspFNI CGCG 1 cut(s) 144
BspPI GGATC 1 cut(s) 176
BsrI ACTGG 1 cut(s) 74
BssECI CCNNGG 4 cut(s) 30, 134, 194, 204
BssMI GATC 2 cut(s) 181, 187
BssNI GRCGYC 1 cut(s) 18
Bst2UI CCWGG 1 cut(s) 195
BstACI GRCGYC 1 cut(s) 18
BstC8I GCNNGC 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 56
BstF5I GGATG 3 cut(s) 79, 89, 100
BstFNI CGCG 1 cut(s) 144
BstKTI GATC 2 cut(s) 184, 190
BstMBI GATC 2 cut(s) 181, 187
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 3 cut(s) 30, 133, 193
BstUI CGCG 1 cut(s) 144
BsuRI GGCC 1 cut(s) 114
BtsCI GGATG 3 cut(s) 79, 89, 100
Cac8I GCNNGC 1 cut(s) 142
CseI GACGC 2 cut(s) 7, 133
Csp6I GTAC 1 cut(s) 215
CviAII CATG 2 cut(s) 40, 80
CviJI RGCY 5 cut(s) 107, 114, 127, 140, 228
CviKI_1 RGCY 5 cut(s) 107, 114, 127, 140, 228
CviQI GTAC 1 cut(s) 215
DdeI CTNAG 1 cut(s) 56
DpnI GATC 2 cut(s) 183, 189
DpnII GATC 2 cut(s) 181, 187
EaeI YGGCCR 1 cut(s) 112
Eco24I GRGCYC 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 193
EcoT38I GRGCYC 1 cut(s) 142
FaeI CATG 2 cut(s) 43, 83
FaiI YATR 4 cut(s) 41, 66, 81, 131
FatI CATG 2 cut(s) 39, 79
FokI GGATG 3 cut(s) 86, 87, 96
FriOI GRGCYC 1 cut(s) 142
FspBI CTAG 1 cut(s) 218
HaeIII GGCC 1 cut(s) 114
HapII CCGG 3 cut(s) 32, 93, 134
HgaI GACGC 2 cut(s) 7, 133
Hin1I GRCGYC 1 cut(s) 18
Hin1II CATG 2 cut(s) 43, 83
HincII GTYRAC 1 cut(s) 22
HindII GTYRAC 1 cut(s) 22
HinfI GANTC 1 cut(s) 150
HpaII CCGG 3 cut(s) 32, 93, 134
HphI GGTGA 1 cut(s) 107
Hpy166II GTNNAC 3 cut(s) 22, 62, 98
Hpy188I TCNGA 2 cut(s) 149, 181
Hpy188III TCNNGA 1 cut(s) 185
Hpy8I GTNNAC 3 cut(s) 22, 62, 98
HpyCH4IV ACGT 1 cut(s) 50
HpyCH4V TGCA 1 cut(s) 87
HpyF3I CTNAG 1 cut(s) 56
HpySE526I ACGT 1 cut(s) 50
Hsp92I GRCGYC 1 cut(s) 18
Hsp92II CATG 2 cut(s) 43, 83
Kzo9I GATC 2 cut(s) 181, 187
LweI GCATC 1 cut(s) 74
MaeI CTAG 1 cut(s) 218
MaeII ACGT 1 cut(s) 50
MaeIII GTNAC 1 cut(s) 151
MalI GATC 2 cut(s) 183, 189
MboI GATC 2 cut(s) 181, 187
MhlI GDGCHC 1 cut(s) 142
MluCI AATT 1 cut(s) 88
MlyI GAGTC 1 cut(s) 159
MnlI CCTC 3 cut(s) 35, 168, 199
MseI TTAA 1 cut(s) 232
MspI CCGG 3 cut(s) 32, 93, 134
MspR9I CCNGG 3 cut(s) 32, 135, 195
MvaI CCWGG 1 cut(s) 195
MvnI CGCG 1 cut(s) 144
NciI CCSGG 2 cut(s) 32, 135
NdeII GATC 2 cut(s) 181, 187
NlaIII CATG 2 cut(s) 43, 83
NmuCI GTSAC 1 cut(s) 151
PleI GAGTC 1 cut(s) 158
PpsI GAGTC 1 cut(s) 158
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
RsaI GTAC 1 cut(s) 216
RsaNI GTAC 1 cut(s) 215
SaqAI TTAA 1 cut(s) 232
Sau3AI GATC 2 cut(s) 181, 187
ScaI AGTACT 1 cut(s) 216
SchI GAGTC 1 cut(s) 159
ScrFI CCNGG 3 cut(s) 32, 135, 195
SduI GDGCHC 1 cut(s) 142
SetI ASST 3 cut(s) 27, 53, 196
SfaNI GCATC 1 cut(s) 74
Sse9I AATT 1 cut(s) 88
SspMI CTAG 1 cut(s) 218
StyD4I CCNGG 3 cut(s) 30, 133, 193
TaiI ACGT 1 cut(s) 53
TaqI TCGA 1 cut(s) 190
TasI AATT 1 cut(s) 88
TatI WGTACW 1 cut(s) 214
Tru1I TTAA 1 cut(s) 232
Tru9I TTAA 1 cut(s) 232
TseFI GTSAC 1 cut(s) 151
Tsp45I GTSAC 1 cut(s) 151
XspI CTAG 1 cut(s) 218
ZrmI AGTACT 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.