Rh2CG049800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0012556
Physical Location & Seq
Reverse (-)
3956507 .. 3956926
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG049800.1

Sequence Viewer

Length: 420 bp
ATGATAAAGGTGAAAGTGATGCAAAATATGGTCACCTTTGCTGATGATATATATGAGATGGAAATAGAAGTCCACCCCATGCAGACACTGAAAAAGATTAGGGAGAAGTTGGCGACGGCAGAAAATTTGAGAGGCTGGCCTCTCCCGACAAATGGATATTCATTTCGGCGTCAACCTCTCCCCGGCAACCATGATGATAACGGTGAAGACTTGCTCAAGGGTGGGGGGAGAACCTTCCCAAAACTCGGAATAAGAAATGGTGATACTATCCTGGTGGTACCATCCAGTTTCCAAGCTAGTGAACATAACTGGGATGGGCATGGATGCAATTCCGGTGAACATCCAGCCATCGGACAAGGTAGTGACTTTGAGAGAGGAGTTGCAAAGACGCCAAACTCAAAATCTCCCAACTTATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

139

Amino Acids

15.43

Weight (kDa)

6.51

Isoelectric Point (pI)

24.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 277
AccB1I GGYRCC 1 cut(s) 277
AcsI RAATTY 1 cut(s) 124
AcyI GRCGYC 2 cut(s) 169, 389
AfaI GTAC 1 cut(s) 279
AfiI CCNNNNNNNGG 4 cut(s) 152, 182, 245, 350
AjnI CCWGG 1 cut(s) 270
AluBI AGCT 1 cut(s) 296
AluI AGCT 1 cut(s) 296
AlwNI CAGNNNCTG 1 cut(s) 88
AoxI GGCC 1 cut(s) 137
ApoI RAATTY 1 cut(s) 124
Asp718I GGTACC 1 cut(s) 277
AsuC2I CCSGG 1 cut(s) 183
AsuHPI GGTGA 5 cut(s) 22, 25, 215, 272, 347
BanI GGYRCC 1 cut(s) 277
BbsI GAAGAC 1 cut(s) 213
BccI CCATC 4 cut(s) 52, 289, 308, 356
BceAI ACGGC 1 cut(s) 132
BciT130I CCWGG 1 cut(s) 272
BcnI CCSGG 1 cut(s) 183
BfaI CTAG 1 cut(s) 297
Bme1390I CCNGG 2 cut(s) 183, 272
BmiI GGNNCC 1 cut(s) 279
BmrFI CCNGG 2 cut(s) 183, 272
BmrI ACTGGG 1 cut(s) 319
BmsI GCATC 2 cut(s) 9, 314
BmuI ACTGGG 1 cut(s) 319
BpiI GAAGAC 1 cut(s) 213
BpuEI CTTGAG 1 cut(s) 200
BpuMI CCSGG 1 cut(s) 183
BsaHI GRCGYC 2 cut(s) 169, 389
BsaJI CCNNGG 1 cut(s) 181
BsaWI WCCGGW 1 cut(s) 332
Bsc4I CCNNNNNNNGG 4 cut(s) 152, 182, 245, 350
Bse1I ACTGG 2 cut(s) 285, 314
BseBI CCWGG 1 cut(s) 272
BseDI CCNNGG 1 cut(s) 181
BseGI GGATG 4 cut(s) 281, 319, 329, 340
BseLI CCNNNNNNNGG 4 cut(s) 152, 182, 245, 350
BseNI ACTGG 2 cut(s) 285, 314
BseRI GAGGAG 1 cut(s) 390
BshFI GGCC 1 cut(s) 139
BshNI GGYRCC 1 cut(s) 277
BsiSI CCGG 2 cut(s) 183, 333
BslI CCNNNNNNNGG 4 cut(s) 152, 182, 245, 350
BsnI GGCC 1 cut(s) 139
BspANI GGCC 1 cut(s) 139
BspLI GGNNCC 1 cut(s) 279
BspT107I GGYRCC 1 cut(s) 277
BsrI ACTGG 2 cut(s) 285, 314
BssECI CCNNGG 1 cut(s) 181
BssNI GRCGYC 2 cut(s) 169, 389
Bst2UI CCWGG 1 cut(s) 272
Bst4CI ACNGT 1 cut(s) 203
BstACI GRCGYC 2 cut(s) 169, 389
BstC8I GCNNGC 1 cut(s) 137
BstEII GGTNACC 1 cut(s) 31
BstF5I GGATG 4 cut(s) 281, 319, 329, 340
BstNI CCWGG 1 cut(s) 272
BstPI GGTNACC 1 cut(s) 31
BstSCI CCNGG 2 cut(s) 181, 270
BstV2I GAAGAC 1 cut(s) 213
BsuRI GGCC 1 cut(s) 139
BtsCI GGATG 4 cut(s) 281, 319, 329, 340
BtsIMutI CAGTG 1 cut(s) 86
Cac8I GCNNGC 1 cut(s) 137
CaiI CAGNNNCTG 1 cut(s) 88
CseI GACGC 2 cut(s) 158, 397
Csp6I GTAC 1 cut(s) 278
CviAII CATG 3 cut(s) 79, 191, 320
CviJI RGCY 4 cut(s) 135, 139, 296, 347
CviKI_1 RGCY 4 cut(s) 135, 139, 296, 347
CviQI GTAC 1 cut(s) 278
Eco91I GGTNACC 1 cut(s) 31
EcoO65I GGTNACC 1 cut(s) 31
EcoRII CCWGG 1 cut(s) 270
FaeI CATG 3 cut(s) 82, 194, 323
FaiI YATR 8 cut(s) 29, 50, 52, 54, 80, 192, 306, 321
FatI CATG 3 cut(s) 78, 190, 319
FokI GGATG 4 cut(s) 268, 326, 327, 336
FspBI CTAG 1 cut(s) 297
HaeIII GGCC 1 cut(s) 139
HapII CCGG 2 cut(s) 183, 333
HgaI GACGC 2 cut(s) 158, 397
Hin1I GRCGYC 2 cut(s) 169, 389
Hin1II CATG 3 cut(s) 82, 194, 323
HincII GTYRAC 1 cut(s) 173
HindII GTYRAC 1 cut(s) 173
HpaII CCGG 2 cut(s) 183, 333
HphI GGTGA 5 cut(s) 22, 25, 215, 272, 347
Hpy166II GTNNAC 4 cut(s) 73, 173, 302, 338
Hpy188I TCNGA 2 cut(s) 248, 353
Hpy188III TCNNGA 1 cut(s) 145
Hpy8I GTNNAC 4 cut(s) 73, 173, 302, 338
Hpy99I CGWCG 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 244
HpyCH4III ACNGT 1 cut(s) 203
HpyCH4V TGCA 4 cut(s) 22, 82, 327, 383
Hsp92I GRCGYC 2 cut(s) 169, 389
Hsp92II CATG 3 cut(s) 82, 194, 323
KpnI GGTACC 1 cut(s) 281
LpnPI CCDG 8 cut(s) 121, 196, 257, 284, 295, 298, 346, 357
LweI GCATC 2 cut(s) 9, 314
MaeI CTAG 1 cut(s) 297
MaeIII GTNAC 2 cut(s) 31, 362
MboII GAAGA 1 cut(s) 218
MluCI AATT 2 cut(s) 124, 328
MnlI CCTC 4 cut(s) 125, 150, 186, 368
MseI TTAA 1 cut(s) 418
MspI CCGG 2 cut(s) 183, 333
MspR9I CCNGG 2 cut(s) 183, 272
MvaI CCWGG 1 cut(s) 272
NciI CCSGG 1 cut(s) 183
NlaIII CATG 3 cut(s) 82, 194, 323
NlaIV GGNNCC 1 cut(s) 279
NmuCI GTSAC 2 cut(s) 31, 362
Psp6I CCWGG 1 cut(s) 270
PspEI GGTNACC 1 cut(s) 31
PspGI CCWGG 1 cut(s) 270
PspN4I GGNNCC 1 cut(s) 279
PstNI CAGNNNCTG 1 cut(s) 88
RsaI GTAC 1 cut(s) 279
RsaNI GTAC 1 cut(s) 278
SaqAI TTAA 1 cut(s) 418
ScrFI CCNGG 2 cut(s) 183, 272
SetI ASST 6 cut(s) 12, 38, 178, 236, 298, 361
SfaNI GCATC 2 cut(s) 9, 314
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 2 cut(s) 124, 328
SspMI CTAG 1 cut(s) 297
StyD4I CCNGG 2 cut(s) 181, 270
TaaI ACNGT 1 cut(s) 203
TasI AATT 2 cut(s) 124, 328
Tru1I TTAA 1 cut(s) 418
Tru9I TTAA 1 cut(s) 418
TscAI CASTG 1 cut(s) 93
TseFI GTSAC 2 cut(s) 31, 362
Tsp45I GTSAC 2 cut(s) 31, 362
TspDTI ATGAA 1 cut(s) 150
TspRI CASTG 1 cut(s) 93
XapI RAATTY 1 cut(s) 124
XspI CTAG 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.