Rroxscaffold_3G00220720

Ribulose bisphosphate carboxylase large chain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
3106102 .. 3108521
2420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00220720.1

Sequence Viewer

Length: 171 bp
ATGAGTTGTAGGGAGGGAAATATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCGGAGTATGAAACCAAAGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCGGAGTTCGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.31

Weight (kDa)

5.18

Isoelectric Point (pI)

49.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 81
AccIII TCCGGA 1 cut(s) 100
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 32
Aor13HI TCCGGA 1 cut(s) 100
ApeKI GCWGC 1 cut(s) 134
AsuHPI GGTGA 1 cut(s) 18
BbvI GCAGC 1 cut(s) 146
BcoDI GTCTC 1 cut(s) 32
BisI GCNGC 1 cut(s) 135
BlsI GCNGC 1 cut(s) 136
BsaWI WCCGGW 2 cut(s) 100, 157
BseAI TCCGGA 1 cut(s) 100
BseRI GAGGAG 1 cut(s) 141
BseXI GCAGC 1 cut(s) 146
BsiSI CCGG 2 cut(s) 101, 158
BsmAI GTCTC 1 cut(s) 32
Bsp13I TCCGGA 1 cut(s) 100
BspEI TCCGGA 1 cut(s) 100
BstMAI GTCTC 1 cut(s) 32
BstV1I GCAGC 1 cut(s) 146
CviJI RGCY 1 cut(s) 65
CviKI_1 RGCY 1 cut(s) 65
Eco32I GATATC 1 cut(s) 127
EcoRV GATATC 1 cut(s) 127
FaiI YATR 4 cut(s) 23, 81, 96, 108
Fnu4HI GCNGC 1 cut(s) 135
Fsp4HI GCNGC 1 cut(s) 135
FspEI CC 9 cut(s) 39, 42, 51, 86, 114, 116, 127, 143, 165
GluI GCNGC 1 cut(s) 135
HapII CCGG 2 cut(s) 101, 158
HinfI GANTC 1 cut(s) 57
HpaII CCGG 2 cut(s) 101, 158
HphI GGTGA 1 cut(s) 18
Hpy188III TCNNGA 1 cut(s) 101
Kpn2I TCCGGA 1 cut(s) 100
LpnPI CCDG 2 cut(s) 51, 114
Lsp1109I GCAGC 1 cut(s) 146
MaeIII GTNAC 2 cut(s) 24, 145
MluCI AATT 1 cut(s) 83
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 2 cut(s) 7, 162
MroI TCCGGA 1 cut(s) 100
MseI TTAA 1 cut(s) 72
MspI CCGG 2 cut(s) 101, 158
NmuCI GTSAC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 57
PkrI GCNGC 1 cut(s) 136
PsiI TTATAA 1 cut(s) 81
SaqAI TTAA 1 cut(s) 72
SatI GCNGC 1 cut(s) 135
SetI ASST 1 cut(s) 67
SgeI CNNG 5 cut(s) 60, 78, 113, 142, 155
Sse9I AATT 1 cut(s) 83
TaqI TCGA 1 cut(s) 142
TasI AATT 1 cut(s) 83
TfiI GAWTC 1 cut(s) 57
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
TseFI GTSAC 1 cut(s) 24
TseI GCWGC 1 cut(s) 134
Tsp45I GTSAC 1 cut(s) 24
TspDTI ATGAA 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.