Rroxscaffold_3G00240470

ribonuclease H protein At1g65750

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
32175013 .. 32175858
846 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00240470.1

Sequence Viewer

Length: 174 bp
ATGTGGCTGGAGCACCCTTCTAATGGAGAAAACAATGAGAAATGGTGGGGCGAACCAAATTTTCAGGGCTGGGAGGGGTTGAAATTTATGAGAAATTCAAGGAGCTTGAAAGGAAATGAAAAAAGGATTGGGGAAGGAAAAAAAGGTTTTATTGGGCCAAAAGAAGTGTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.65

Weight (kDa)

8.93

Isoelectric Point (pI)

16.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 58, 83, 94
AfiI CCNNNNNNNGG 1 cut(s) 23
AgsI TTSAA 3 cut(s) 82, 99, 109
AjuI GAANNNNNNNTTGG 2 cut(s) 111, 143
AluBI AGCT 1 cut(s) 105
AluI AGCT 1 cut(s) 105
Alw21I GWGCWC 1 cut(s) 15
AoxI GGCC 1 cut(s) 155
ApoI RAATTY 3 cut(s) 58, 83, 94
AspS9I GGNCC 1 cut(s) 155
Bbv12I GWGCWC 1 cut(s) 15
BmgT120I GGNCC 1 cut(s) 155
BpmI CTGGAG 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 23
BseLI CCNNNNNNNGG 1 cut(s) 23
BseYI CCCAGC 1 cut(s) 69
BshFI GGCC 1 cut(s) 157
BsiHKAI GWGCWC 1 cut(s) 15
BslI CCNNNNNNNGG 1 cut(s) 23
BsnI GGCC 1 cut(s) 157
Bsp1286I GDGCHC 1 cut(s) 15
BspANI GGCC 1 cut(s) 157
BsuRI GGCC 1 cut(s) 157
Cfr13I GGNCC 1 cut(s) 155
CviJI RGCY 4 cut(s) 7, 69, 105, 157
CviKI_1 RGCY 4 cut(s) 7, 69, 105, 157
FaiI YATR 1 cut(s) 89
GsaI CCCAGC 1 cut(s) 73
GsuI CTGGAG 1 cut(s) 29
HaeIII GGCC 1 cut(s) 157
HpyAV CCTTC 2 cut(s) 27, 128
LmnI GCTCC 2 cut(s) 10, 102
LpnPI CCDG 2 cut(s) 50, 55
MhlI GDGCHC 1 cut(s) 15
MluCI AATT 3 cut(s) 58, 83, 94
MnlI CCTC 1 cut(s) 67
MseI TTAA 1 cut(s) 172
PspFI CCCAGC 1 cut(s) 69
PspPI GGNCC 1 cut(s) 155
SaqAI TTAA 1 cut(s) 172
Sau96I GGNCC 1 cut(s) 155
SduI GDGCHC 1 cut(s) 15
SetI ASST 2 cut(s) 107, 148
SgeI CNNG 5 cut(s) 20, 77, 82, 111, 118
Sse9I AATT 3 cut(s) 58, 83, 94
TasI AATT 3 cut(s) 58, 83, 94
Tru1I TTAA 1 cut(s) 172
Tru9I TTAA 1 cut(s) 172
TspDTI ATGAA 1 cut(s) 132
XapI RAATTY 3 cut(s) 58, 83, 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.