Rroxscaffold_6G00396430

NifU-like protein 1

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
17934619 .. 17940220
5602 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00396430.1

Sequence Viewer

Length: 162 bp
ATGGGGATTGAACGAATGCTTAAAGAAAAGTTTGGAGATGCACTCAAGGATATTCAACAAGTCTTTGATGAAGAAAACAGAGAGACCACAATGAGAGGGGAAGGGAGAAGATGGTTTGGTACTTCATATGGTATTGCTAGTAGAAGTGAGAAGGGGGAGTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

6.17

Weight (kDa)

5.44

Isoelectric Point (pI)

48.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017763)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 121
AgsI TTSAA 2 cut(s) 11, 56
Alw26I GTCTC 1 cut(s) 77
BccI CCATC 1 cut(s) 105
BcoDI GTCTC 1 cut(s) 77
BfaI CTAG 1 cut(s) 138
BmsI GCATC 1 cut(s) 28
BplI GAGNNNNNCTC 2 cut(s) 27, 59
BpuEI CTTGAG 1 cut(s) 29
BsaI GGTCTC 1 cut(s) 77
BsmAI GTCTC 1 cut(s) 77
BsmI GAATGC 1 cut(s) 21
Bso31I GGTCTC 1 cut(s) 77
BspTNI GGTCTC 1 cut(s) 77
BstMAI GTCTC 1 cut(s) 77
Csp6I GTAC 1 cut(s) 120
CviQI GTAC 1 cut(s) 120
Eco31I GGTCTC 1 cut(s) 77
FaiI YATR 2 cut(s) 127, 129
FauNDI CATATG 1 cut(s) 127
FspBI CTAG 1 cut(s) 138
HpyAV CCTTC 2 cut(s) 95, 145
HpyCH4V TGCA 1 cut(s) 41
LweI GCATC 1 cut(s) 28
MaeI CTAG 1 cut(s) 138
MboII GAAGA 2 cut(s) 83, 120
MnlI CCTC 1 cut(s) 89
MseI TTAA 1 cut(s) 21
Mva1269I GAATGC 1 cut(s) 21
NdeI CATATG 1 cut(s) 127
PctI GAATGC 1 cut(s) 21
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SaqAI TTAA 1 cut(s) 21
SfaNI GCATC 1 cut(s) 28
SgeI CNNG 3 cut(s) 58, 71, 150
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
SspMI CTAG 1 cut(s) 138
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TspDTI ATGAA 2 cut(s) 84, 114
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.