Rroxscaffold_6G00405120

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
27570551 .. 27571407
857 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00405120.1

Sequence Viewer

Length: 279 bp
ATGAAGAAACTGATCATGGGGACGTTTCCGATGAAGAGGAACATTAACCAGGACCAGATGGCAAGTCCAAAATTCCCATCCAAAGATGCTGTTAACCGGGAGGGTTTGGCAAGTCAATACCAGTTAAGAAAATCCCGGCAGAATATGCAGAAATTCCTACGAATTCTGATATTTCGTTTTAGTTCAAGAGGTGCAAGTGATGCAGATGGAGCTTCGTATTCTAAAGCAAAGGGATCTGTGAGAAAACAGAGGACTGGATATAAAGGCAAAAACCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.51

Weight (kDa)

11.12

Isoelectric Point (pI)

40.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 241
AcsI RAATTY 3 cut(s) 71, 152, 162
AgsI TTSAA 1 cut(s) 186
AjnI CCWGG 1 cut(s) 48
AluBI AGCT 1 cut(s) 212
AluI AGCT 1 cut(s) 212
AlwI GGATC 1 cut(s) 241
ApoI RAATTY 3 cut(s) 71, 152, 162
AspS9I GGNCC 1 cut(s) 52
AsuC2I CCSGG 2 cut(s) 98, 136
AvaII GGWCC 1 cut(s) 52
BccI CCATC 3 cut(s) 52, 85, 200
BciT130I CCWGG 1 cut(s) 50
BclI TGATCA 1 cut(s) 12
BcnI CCSGG 2 cut(s) 98, 136
Bme1390I CCNGG 3 cut(s) 50, 98, 136
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 52
BmrFI CCNGG 3 cut(s) 50, 98, 136
BmsI GCATC 2 cut(s) 76, 190
BpuMI CCSGG 2 cut(s) 98, 136
Bse1I ACTGG 3 cut(s) 121, 259, 274
BseBI CCWGG 1 cut(s) 50
BseGI GGATG 1 cut(s) 77
BseNI ACTGG 3 cut(s) 121, 259, 274
BsiSI CCGG 2 cut(s) 97, 136
BslFI GGGAC 1 cut(s) 34
BsmFI GGGAC 1 cut(s) 34
Bsp143I GATC 2 cut(s) 12, 233
BspPI GGATC 1 cut(s) 241
BsrI ACTGG 3 cut(s) 121, 259, 274
BssMI GATC 2 cut(s) 12, 233
Bst2UI CCWGG 1 cut(s) 50
Bst6I CTCTTC 1 cut(s) 29
BstAPI GCANNNNNTGC 2 cut(s) 145, 200
BstF5I GGATG 1 cut(s) 77
BstKTI GATC 2 cut(s) 15, 236
BstMBI GATC 2 cut(s) 12, 233
BstMWI GCNNNNNNNGC 3 cut(s) 145, 200, 209
BstNI CCWGG 1 cut(s) 50
BstSCI CCNGG 3 cut(s) 48, 96, 134
BstX2I RGATCY 1 cut(s) 233
BstYI RGATCY 1 cut(s) 233
BtsCI GGATG 1 cut(s) 77
Cfr13I GGNCC 1 cut(s) 52
CviAII CATG 1 cut(s) 16
CviJI RGCY 1 cut(s) 212
CviKI_1 RGCY 1 cut(s) 212
DpnI GATC 2 cut(s) 14, 235
DpnII GATC 2 cut(s) 12, 233
Eam1104I CTCTTC 1 cut(s) 29
EarI CTCTTC 1 cut(s) 29
Eco47I GGWCC 1 cut(s) 52
EcoRI GAATTC 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 48
FaeI CATG 1 cut(s) 19
FaiI YATR 3 cut(s) 17, 146, 261
FaqI GGGAC 1 cut(s) 34
FatI CATG 1 cut(s) 15
FbaI TGATCA 1 cut(s) 12
FokI GGATG 1 cut(s) 64
HapII CCGG 2 cut(s) 97, 136
Hin1II CATG 1 cut(s) 19
HincII GTYRAC 1 cut(s) 94
HindII GTYRAC 1 cut(s) 94
HpaI GTTAAC 1 cut(s) 94
HpaII CCGG 2 cut(s) 97, 136
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 30, 168
Hpy188III TCNNGA 1 cut(s) 186
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4IV ACGT 1 cut(s) 23
HpyCH4V TGCA 3 cut(s) 148, 194, 203
HpyF10VI GCNNNNNNNGC 3 cut(s) 145, 200, 209
HpySE526I ACGT 1 cut(s) 23
Hsp92II CATG 1 cut(s) 19
Ksp22I TGATCA 1 cut(s) 12
KspAI GTTAAC 1 cut(s) 94
Kzo9I GATC 2 cut(s) 12, 233
LmnI GCTCC 1 cut(s) 209
LpnPI CCDG 7 cut(s) 35, 62, 68, 110, 134, 149, 240
LweI GCATC 2 cut(s) 76, 190
MaeII ACGT 1 cut(s) 23
MalI GATC 2 cut(s) 14, 235
MboI GATC 2 cut(s) 12, 233
MboII GAAGA 2 cut(s) 16, 46
MflI RGATCY 1 cut(s) 233
MluCI AATT 3 cut(s) 71, 152, 162
MnlI CCTC 4 cut(s) 30, 94, 182, 243
MseI TTAA 3 cut(s) 45, 93, 125
MspI CCGG 2 cut(s) 97, 136
MspR9I CCNGG 3 cut(s) 50, 98, 136
MvaI CCWGG 1 cut(s) 50
MwoI GCNNNNNNNGC 3 cut(s) 145, 200, 209
NciI CCSGG 2 cut(s) 98, 136
NdeII GATC 2 cut(s) 12, 233
NlaIII CATG 1 cut(s) 19
Psp6I CCWGG 1 cut(s) 48
PspGI CCWGG 1 cut(s) 48
PspPI GGNCC 1 cut(s) 52
PsuI RGATCY 1 cut(s) 233
SaqAI TTAA 3 cut(s) 45, 93, 125
Sau3AI GATC 2 cut(s) 12, 233
Sau96I GGNCC 1 cut(s) 52
ScrFI CCNGG 3 cut(s) 50, 98, 136
SetI ASST 3 cut(s) 26, 193, 214
SfaNI GCATC 2 cut(s) 76, 190
SinI GGWCC 1 cut(s) 52
Sse9I AATT 3 cut(s) 71, 152, 162
StyD4I CCNGG 3 cut(s) 48, 96, 134
TaiI ACGT 1 cut(s) 26
TasI AATT 3 cut(s) 71, 152, 162
Tru1I TTAA 3 cut(s) 45, 93, 125
Tru9I TTAA 3 cut(s) 45, 93, 125
TspDTI ATGAA 2 cut(s) 17, 47
VpaK11BI GGWCC 1 cut(s) 52
XapI RAATTY 3 cut(s) 71, 152, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.