Rroxscaffold_6G00426350

ALBINO3-like protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
47106398 .. 47108786
2389 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00426350.1

Sequence Viewer

Length: 282 bp
ATGGCTAATTGCAATCCCCATGGTTCGGCTCTGGCTGATCCTCGTGTATGTGCAAAGTGGGGGTTGCCAGAAAAGAATCATAGTCAAGAGACTTCGAGTTGTGAGGAGTTGGATAATTCTAGACTATCACCCTTGGTCTCTCCTATGGAATCAAAAAAGATATCTCCGCAGATCCCATCCCCTAGAGATCTGAGTAATGTGAGTATTTATGAAGTAAAACGTTTGTGCAATCTGTGTTTTTCAAATGTTTCTGTAGGTATTTGCACAGTCGTAACTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.1

Weight (kDa)

6.7

Isoelectric Point (pI)

51.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 167
AclI AACGTT 1 cut(s) 220
AclWI GGATC 2 cut(s) 32, 166
AfiI CCNNNNNNNGG 1 cut(s) 25
AgsI TTSAA 1 cut(s) 243
Alw26I GTCTC 2 cut(s) 83, 142
AlwI GGATC 2 cut(s) 32, 166
AsuHPI GGTGA 1 cut(s) 120
BauI CACGAG 1 cut(s) 42
BccI CCATC 1 cut(s) 184
BcoDI GTCTC 2 cut(s) 83, 142
BfaI CTAG 2 cut(s) 120, 183
BfmI CTRYAG 1 cut(s) 252
BglII AGATCT 1 cut(s) 187
BsaI GGTCTC 1 cut(s) 142
BsaJI CCNNGG 2 cut(s) 19, 132
Bsc4I CCNNNNNNNGG 1 cut(s) 25
BseDI CCNNGG 2 cut(s) 19, 132
BseGI GGATG 1 cut(s) 176
BseLI CCNNNNNNNGG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 182
BseRI GAGGAG 1 cut(s) 119
BslI CCNNNNNNNGG 1 cut(s) 25
BsmAI GTCTC 2 cut(s) 83, 142
Bso31I GGTCTC 1 cut(s) 142
Bsp143I GATC 3 cut(s) 37, 171, 187
Bsp19I CCATGG 1 cut(s) 19
BspACI CCGC 1 cut(s) 167
BspCNI CTCAG 1 cut(s) 183
BspPI GGATC 2 cut(s) 32, 166
BspTNI GGTCTC 1 cut(s) 142
BssECI CCNNGG 2 cut(s) 19, 132
BssMI GATC 3 cut(s) 37, 171, 187
BssSI CACGAG 1 cut(s) 42
BssT1I CCWWGG 2 cut(s) 19, 132
Bst2BI CACGAG 1 cut(s) 42
Bst4CI ACNGT 1 cut(s) 268
BstDEI CTNAG 1 cut(s) 191
BstDSI CCRYGG 1 cut(s) 19
BstF5I GGATG 1 cut(s) 176
BstKTI GATC 3 cut(s) 40, 174, 190
BstMAI GTCTC 2 cut(s) 83, 142
BstMBI GATC 3 cut(s) 37, 171, 187
BstSFI CTRYAG 1 cut(s) 252
BstX2I RGATCY 2 cut(s) 171, 187
BstYI RGATCY 2 cut(s) 171, 187
BtgI CCRYGG 1 cut(s) 19
BtsCI GGATG 1 cut(s) 176
CviAII CATG 1 cut(s) 20
CviJI RGCY 3 cut(s) 5, 29, 35
CviKI_1 RGCY 3 cut(s) 5, 29, 35
DdeI CTNAG 1 cut(s) 191
DpnI GATC 3 cut(s) 39, 173, 189
DpnII GATC 3 cut(s) 37, 171, 187
Eco130I CCWWGG 2 cut(s) 19, 132
Eco31I GGTCTC 1 cut(s) 142
Eco32I GATATC 1 cut(s) 162
EcoRV GATATC 1 cut(s) 162
EcoT14I CCWWGG 2 cut(s) 19, 132
ErhI CCWWGG 2 cut(s) 19, 132
FaeI CATG 1 cut(s) 23
FaiI YATR 6 cut(s) 21, 49, 81, 146, 210, 280
FatI CATG 1 cut(s) 19
FokI GGATG 1 cut(s) 163
FspBI CTAG 2 cut(s) 120, 183
Hin1II CATG 1 cut(s) 23
HinfI GANTC 2 cut(s) 76, 149
HphI GGTGA 1 cut(s) 120
Hpy188I TCNGA 1 cut(s) 192
Hpy188III TCNNGA 2 cut(s) 86, 120
HpyCH4III ACNGT 1 cut(s) 268
HpyCH4IV ACGT 1 cut(s) 220
HpyCH4V TGCA 4 cut(s) 12, 53, 228, 264
HpyF3I CTNAG 1 cut(s) 191
HpySE526I ACGT 1 cut(s) 220
Hsp92II CATG 1 cut(s) 23
Kzo9I GATC 3 cut(s) 37, 171, 187
LpnPI CCDG 2 cut(s) 17, 81
MaeI CTAG 2 cut(s) 120, 183
MaeII ACGT 1 cut(s) 220
MaeIII GTNAC 1 cut(s) 271
MalI GATC 3 cut(s) 39, 173, 189
MboI GATC 3 cut(s) 37, 171, 187
MflI RGATCY 2 cut(s) 171, 187
MluCI AATT 2 cut(s) 7, 115
MmeI TCCRAC 1 cut(s) 90
MnlI CCTC 2 cut(s) 51, 97
NcoI CCATGG 1 cut(s) 19
NdeII GATC 3 cut(s) 37, 171, 187
NlaIII CATG 1 cut(s) 23
PfeI GAWTC 2 cut(s) 76, 149
Psp1406I AACGTT 1 cut(s) 220
PsuI RGATCY 2 cut(s) 171, 187
Sau3AI GATC 3 cut(s) 37, 171, 187
SetI ASST 2 cut(s) 223, 259
SfcI CTRYAG 1 cut(s) 252
Sse9I AATT 2 cut(s) 7, 115
SsiI CCGC 1 cut(s) 167
SspMI CTAG 2 cut(s) 120, 183
StyI CCWWGG 2 cut(s) 19, 132
TaaI ACNGT 1 cut(s) 268
TaiI ACGT 1 cut(s) 223
TaqI TCGA 1 cut(s) 95
TasI AATT 2 cut(s) 7, 115
TfiI GAWTC 2 cut(s) 76, 149
TspDTI ATGAA 2 cut(s) 225, 267
XbaI TCTAGA 1 cut(s) 119
XspI CTAG 2 cut(s) 120, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.