Rorug01G0029800

Intron-binding protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
5070814 .. 5082332
11519 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0029800.1

Sequence Viewer

Length: 180 bp
ATGTTGAGTGATATCTCCCCTGCTCTCAATCTTCCAGATAAATGTGCAGATGACAAACCTTTCACACCAACTTACCAGGTATGCAAGGAAAGAGCTCAAACTTTGGGTGTAAAGTATACTCCGCTTGAATTGTCTCTGAAGGATACCGTTGAAAGTTTGAAGGACAAGAACTTCTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.66

Weight (kDa)

5.13

Isoelectric Point (pI)

10.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 116
AciI CCGC 1 cut(s) 122
AcuI CTGAAG 1 cut(s) 158
AgsI TTSAA 3 cut(s) 128, 152, 160
AjnI CCWGG 1 cut(s) 75
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
Alw21I GWGCWC 1 cut(s) 97
Alw26I GTCTC 1 cut(s) 138
Asp700I GAANNNNTTC 1 cut(s) 173
BanII GRGCYC 1 cut(s) 97
Bbv12I GWGCWC 1 cut(s) 97
BciT130I CCWGG 1 cut(s) 77
BciVI GTATCC 1 cut(s) 136
BcoDI GTCTC 1 cut(s) 138
BfuI GTATCC 1 cut(s) 136
Bme1390I CCNGG 1 cut(s) 77
BmrFI CCNGG 1 cut(s) 77
BseBI CCWGG 1 cut(s) 77
BsgI GTGCAG 1 cut(s) 66
BsiHKAI GWGCWC 1 cut(s) 97
BsmAI GTCTC 1 cut(s) 138
Bsp1286I GDGCHC 1 cut(s) 97
BspACI CCGC 1 cut(s) 122
BssNAI GTATAC 1 cut(s) 117
Bst1107I GTATAC 1 cut(s) 117
Bst2UI CCWGG 1 cut(s) 77
Bst4CI ACNGT 1 cut(s) 148
BstMAI GTCTC 1 cut(s) 138
BstNI CCWGG 1 cut(s) 77
BstSCI CCNGG 1 cut(s) 75
BstZ17I GTATAC 1 cut(s) 117
BsuI GTATCC 1 cut(s) 136
CsiI ACCWGGT 1 cut(s) 75
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
Ecl136II GAGCTC 1 cut(s) 95
Eco24I GRGCYC 1 cut(s) 97
Eco32I GATATC 1 cut(s) 13
Eco53kI GAGCTC 1 cut(s) 95
Eco57I CTGAAG 1 cut(s) 158
EcoICRI GAGCTC 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 75
EcoRV GATATC 1 cut(s) 13
EcoT38I GRGCYC 1 cut(s) 97
FaiI YATR 2 cut(s) 82, 117
FalI AAGNNNNNCTT 1 cut(s) 158
FblI GTMKAC 1 cut(s) 116
FriOI GRGCYC 1 cut(s) 97
Hpy166II GTNNAC 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 138
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 1 cut(s) 117
HpyAV CCTTC 2 cut(s) 133, 154
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4V TGCA 2 cut(s) 47, 84
LpnPI CCDG 4 cut(s) 33, 48, 62, 89
MabI ACCWGGT 1 cut(s) 75
MboII GAAGA 2 cut(s) 23, 166
MhlI GDGCHC 1 cut(s) 97
MluCI AATT 1 cut(s) 128
MroXI GAANNNNTTC 1 cut(s) 173
MspR9I CCNGG 1 cut(s) 77
MvaI CCWGG 1 cut(s) 77
PdmI GAANNNNTTC 1 cut(s) 173
Psp124BI GAGCTC 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 75
PspGI CCWGG 1 cut(s) 75
SacI GAGCTC 1 cut(s) 97
ScrFI CCNGG 1 cut(s) 77
SduI GDGCHC 1 cut(s) 97
SetI ASST 3 cut(s) 61, 81, 97
SexAI ACCWGGT 1 cut(s) 75
SgeI CNNG 6 cut(s) 32, 47, 88, 89, 97, 137
Sse9I AATT 1 cut(s) 128
SsiI CCGC 1 cut(s) 122
SstI GAGCTC 1 cut(s) 97
StyD4I CCNGG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 148
TasI AATT 1 cut(s) 128
XmiI GTMKAC 1 cut(s) 116
XmnI GAANNNNTTC 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.