Rorug01G0075500

Dr1-associated corepressor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0011860
Physical Location & Seq
Forward (+)
12256517 .. 12256852
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0075500.1

Sequence Viewer

Length: 336 bp
ATGTGGGAGGGTACTGCTCGGAGTCCTACATATATTTTACTCAGTTGTATGACTTGGCTAGAGGAATTCCAAAGGTCACGAGCTAGTGATGAATTACCAAAGCAAACTCGTACACAACTTTGGAAGCCTGCAACTACAGGTACATTAAAGCTGAATCTTGATGGGGCCTTTGTGCCTCAACTAACTAAGGGTGGACTTGGAGGCATTCTCCGAAACTCTAGTGGCCAATTTATTGCTGCATTTTATAAAGTTGACCACTTTGTGAGTTCTGCTCTCTATGGTGAACTTCTGGCTATACAGGCTGGTCTAGAGCTTATCAGGATGAGAAATTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CBFD_NFYB_HMF

Protein Analysis

111

Amino Acids

12.44

Weight (kDa)

9.25

Isoelectric Point (pI)

45.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 52 - 107 1e-05 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011860)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G12480
fragaria_vesca FvH4_7g04210
malus_domestica MD02G1273400.v1.1 MD07G1042300.v1.1
prunus_persica Prupe.2G047600_v2.0.a1
pyrus_communis pycom02g23430 pycom07g02990
rosa_chinensis RchiOBHm_Chr1g0328631 RchiOBHm_Chr1g0328761
rosa_laevigata RLG00000029919
rosa_roxburghii Rroxscaffold_4G00321380
rosa_rugosa Rorug01G0075500
rosa_samantha Rh1AG094500 Rh1BG075000 Rh1CG090700 Rh1CG091000 Rh1DG097100 Rh1DG097700
rosa_wichuraiana Rw1G007370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 246
AcoI YGGCCR 1 cut(s) 223
AcsI RAATTY 1 cut(s) 65
AdeI CACNNNGTG 1 cut(s) 262
AfaI GTAC 3 cut(s) 13, 112, 142
AluBI AGCT 3 cut(s) 83, 151, 313
AluI AGCT 3 cut(s) 83, 151, 313
AoxI GGCC 2 cut(s) 165, 223
ApeKI GCWGC 1 cut(s) 236
ApoI RAATTY 1 cut(s) 65
AspS9I GGNCC 1 cut(s) 165
AsuHPI GGTGA 1 cut(s) 293
BalI TGGCCA 1 cut(s) 225
BauI CACGAG 1 cut(s) 78
BbvI GCAGC 1 cut(s) 223
BccI CCATC 1 cut(s) 155
BfaI CTAG 5 cut(s) 59, 84, 219, 308, 334
BfmI CTRYAG 1 cut(s) 135
BisI GCNGC 1 cut(s) 237
BlsI GCNGC 1 cut(s) 238
BmgT120I GGNCC 1 cut(s) 165
BmiI GGNNCC 1 cut(s) 166
BplI GAGNNNNNCTC 4 cut(s) 192, 224, 256, 288
BseGI GGATG 1 cut(s) 327
BseMII CTCAG 1 cut(s) 55
BseXI GCAGC 1 cut(s) 223
BshFI GGCC 2 cut(s) 167, 225
BsmI GAATGC 1 cut(s) 204
BsnI GGCC 2 cut(s) 167, 225
BspANI GGCC 2 cut(s) 167, 225
BspCNI CTCAG 1 cut(s) 54
BspLI GGNNCC 1 cut(s) 166
BssSI CACGAG 1 cut(s) 78
Bst2BI CACGAG 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 129
BstDEI CTNAG 2 cut(s) 41, 186
BstF5I GGATG 1 cut(s) 327
BstMWI GCNNNNNNNGC 1 cut(s) 299
BstSFI CTRYAG 1 cut(s) 135
BstV1I GCAGC 1 cut(s) 223
BsuRI GGCC 2 cut(s) 167, 225
BtsCI GGATG 1 cut(s) 327
Cac8I GCNNGC 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 165
Csp6I GTAC 3 cut(s) 12, 111, 141
CviJI RGCY 9 cut(s) 58, 83, 127, 151, 167, 225, 293, 302, 313
CviKI_1 RGCY 9 cut(s) 58, 83, 127, 151, 167, 225, 293, 302, 313
CviQI GTAC 3 cut(s) 12, 111, 141
DdeI CTNAG 2 cut(s) 41, 186
DraIII CACNNNGTG 1 cut(s) 262
EaeI YGGCCR 1 cut(s) 223
EcoO109I RGGNCCY 1 cut(s) 165
EcoRI GAATTC 1 cut(s) 65
FaiI YATR 6 cut(s) 31, 33, 50, 246, 279, 296
Fnu4HI GCNGC 1 cut(s) 237
Fsp4HI GCNGC 1 cut(s) 237
FspBI CTAG 5 cut(s) 59, 84, 219, 308, 334
GluI GCNGC 1 cut(s) 237
HaeIII GGCC 2 cut(s) 167, 225
HincII GTYRAC 1 cut(s) 253
HindII GTYRAC 1 cut(s) 253
HinfI GANTC 2 cut(s) 22, 154
HphI GGTGA 1 cut(s) 293
Hpy166II GTNNAC 4 cut(s) 113, 194, 253, 284
Hpy188I TCNGA 2 cut(s) 21, 212
Hpy188III TCNNGA 4 cut(s) 78, 158, 308, 319
Hpy8I GTNNAC 4 cut(s) 113, 194, 253, 284
HpyCH4V TGCA 2 cut(s) 131, 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 299
HpyF3I CTNAG 2 cut(s) 41, 186
LpnPI CCDG 6 cut(s) 123, 141, 275, 284, 288, 304
Lsp1109I GCAGC 1 cut(s) 223
MaeI CTAG 5 cut(s) 59, 84, 219, 308, 334
MaeIII GTNAC 1 cut(s) 75
MlsI TGGCCA 1 cut(s) 225
MluCI AATT 4 cut(s) 65, 92, 227, 328
MluNI TGGCCA 1 cut(s) 225
MlyI GAGTC 1 cut(s) 31
MnlI CCTC 3 cut(s) 55, 186, 194
Mox20I TGGCCA 1 cut(s) 225
MscI TGGCCA 1 cut(s) 225
MseI TTAA 1 cut(s) 146
Msp20I TGGCCA 1 cut(s) 225
Mva1269I GAATGC 1 cut(s) 204
MwoI GCNNNNNNNGC 1 cut(s) 299
NlaIV GGNNCC 1 cut(s) 166
NmuCI GTSAC 1 cut(s) 75
PctI GAATGC 1 cut(s) 204
PfeI GAWTC 1 cut(s) 154
PkrI GCNGC 1 cut(s) 238
PleI GAGTC 1 cut(s) 30
PpsI GAGTC 1 cut(s) 30
PsiI TTATAA 1 cut(s) 246
PspN4I GGNNCC 1 cut(s) 166
PspPI GGNCC 1 cut(s) 165
RsaI GTAC 3 cut(s) 13, 112, 142
RsaNI GTAC 3 cut(s) 12, 111, 141
SaqAI TTAA 1 cut(s) 146
SatI GCNGC 1 cut(s) 237
Sau96I GGNCC 1 cut(s) 165
SchI GAGTC 1 cut(s) 31
SetI ASST 5 cut(s) 77, 85, 142, 153, 315
SfcI CTRYAG 1 cut(s) 135
Sse9I AATT 4 cut(s) 65, 92, 227, 328
SspMI CTAG 5 cut(s) 59, 84, 219, 308, 334
TasI AATT 4 cut(s) 65, 92, 227, 328
TfiI GAWTC 1 cut(s) 154
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TseFI GTSAC 1 cut(s) 75
TseI GCWGC 1 cut(s) 236
Tsp45I GTSAC 1 cut(s) 75
TspDTI ATGAA 1 cut(s) 105
XapI RAATTY 1 cut(s) 65
XbaI TCTAGA 1 cut(s) 307
XspI CTAG 5 cut(s) 59, 84, 219, 308, 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.