Rorug01G0280400

Protein of unknown function (DUF4079)

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
39396729 .. 39397197
469 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0280400.1

Sequence Viewer

Length: 240 bp
ATGGCAGGACATTTTTCTGAGGCTTATCTTGCACGGCTCTTAGATGAGGATACCAAAATATGTGGTGAGTACCTATCATTGTTCACTAATGATCTAGAGCTTAATAACCATGTTTCGGAGCAACACATCAGGAGCACTGTGGCTAAGCAGGCTGCTGCTGCTGCTAAATTGATCAAAAAGCTAATTGAGTGCCCATTGTGTAAAGAGGAAAGAAGTGTTCCAAGAAGTTCAGCAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.76

Weight (kDa)

6.27

Isoelectric Point (pI)

57.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011218)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 71
AfiI CCNNNNNNNGG 1 cut(s) 115
AluBI AGCT 2 cut(s) 100, 181
AluI AGCT 2 cut(s) 100, 181
Alw21I GWGCWC 1 cut(s) 137
ApeKI GCWGC 4 cut(s) 152, 155, 158, 161
AsuHPI GGTGA 1 cut(s) 77
BaeGI GKGCMC 1 cut(s) 194
Bbv12I GWGCWC 1 cut(s) 137
BbvI GCAGC 4 cut(s) 139, 142, 145, 148
BceAI ACGGC 1 cut(s) 50
BciVI GTATCC 1 cut(s) 43
BclI TGATCA 1 cut(s) 171
BfaI CTAG 1 cut(s) 95
BfuI GTATCC 1 cut(s) 43
BisI GCNGC 4 cut(s) 153, 156, 159, 162
BlpI GCTNAGC 1 cut(s) 144
BlsI GCNGC 4 cut(s) 154, 157, 160, 163
Bpu1102I GCTNAGC 1 cut(s) 144
Bsc4I CCNNNNNNNGG 1 cut(s) 115
BseLI CCNNNNNNNGG 1 cut(s) 115
BseMII CTCAG 1 cut(s) 9
BseSI GKGCMC 1 cut(s) 194
BseXI GCAGC 4 cut(s) 139, 142, 145, 148
BsiHKAI GWGCWC 1 cut(s) 137
BslI CCNNNNNNNGG 1 cut(s) 115
Bsp1286I GDGCHC 2 cut(s) 137, 194
Bsp143I GATC 2 cut(s) 91, 171
Bsp1720I GCTNAGC 1 cut(s) 144
BspCNI CTCAG 1 cut(s) 10
BssMI GATC 2 cut(s) 91, 171
Bst4CI ACNGT 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 150
BstDEI CTNAG 3 cut(s) 18, 40, 144
BstKTI GATC 2 cut(s) 94, 174
BstMBI GATC 2 cut(s) 91, 171
BstMWI GCNNNNNNNGC 4 cut(s) 29, 149, 158, 161
BstSLI GKGCMC 1 cut(s) 194
BstV1I GCAGC 4 cut(s) 139, 142, 145, 148
BsuI GTATCC 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 135
Cac8I GCNNGC 1 cut(s) 150
Csp6I GTAC 1 cut(s) 70
CspCI CAANNNNNGTGG 2 cut(s) 43, 78
CviAII CATG 1 cut(s) 110
CviJI RGCY 6 cut(s) 23, 37, 100, 143, 152, 181
CviKI_1 RGCY 6 cut(s) 23, 37, 100, 143, 152, 181
CviQI GTAC 1 cut(s) 70
DdeI CTNAG 3 cut(s) 18, 40, 144
DpnI GATC 2 cut(s) 93, 173
DpnII GATC 2 cut(s) 91, 171
FaeI CATG 1 cut(s) 113
FaiI YATR 2 cut(s) 61, 111
FatI CATG 1 cut(s) 109
FbaI TGATCA 1 cut(s) 171
Fnu4HI GCNGC 4 cut(s) 153, 156, 159, 162
Fsp4HI GCNGC 4 cut(s) 153, 156, 159, 162
FspBI CTAG 1 cut(s) 95
GluI GCNGC 4 cut(s) 153, 156, 159, 162
Hin1II CATG 1 cut(s) 113
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 84
Hpy188I TCNGA 2 cut(s) 19, 118
Hpy188III TCNNGA 2 cut(s) 95, 130
Hpy8I GTNNAC 1 cut(s) 84
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4V TGCA 1 cut(s) 32
HpyF10VI GCNNNNNNNGC 4 cut(s) 29, 149, 158, 161
HpyF3I CTNAG 3 cut(s) 18, 40, 144
Hsp92II CATG 1 cut(s) 113
Ksp22I TGATCA 1 cut(s) 171
Kzo9I GATC 2 cut(s) 91, 171
LmnI GCTCC 2 cut(s) 118, 132
LpnPI CCDG 2 cut(s) 115, 134
Lsp1109I GCAGC 4 cut(s) 139, 142, 145, 148
MaeI CTAG 1 cut(s) 95
MalI GATC 2 cut(s) 93, 173
MboI GATC 2 cut(s) 91, 171
MhlI GDGCHC 2 cut(s) 137, 194
MluCI AATT 2 cut(s) 167, 183
MnlI CCTC 3 cut(s) 13, 40, 199
MseI TTAA 1 cut(s) 102
MwoI GCNNNNNNNGC 4 cut(s) 29, 149, 158, 161
NdeII GATC 2 cut(s) 91, 171
NlaIII CATG 1 cut(s) 113
PkrI GCNGC 4 cut(s) 154, 157, 160, 163
RsaI GTAC 1 cut(s) 71
RsaNI GTAC 1 cut(s) 70
SaqAI TTAA 1 cut(s) 102
SatI GCNGC 4 cut(s) 153, 156, 159, 162
Sau3AI GATC 2 cut(s) 91, 171
SduI GDGCHC 2 cut(s) 137, 194
SetI ASST 3 cut(s) 75, 102, 183
SgeI CNNG 8 cut(s) 18, 41, 45, 107, 122, 142, 161, 234
Sse9I AATT 2 cut(s) 167, 183
SspMI CTAG 1 cut(s) 95
TaaI ACNGT 1 cut(s) 139
TasI AATT 2 cut(s) 167, 183
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TscAI CASTG 1 cut(s) 142
TseI GCWGC 4 cut(s) 152, 155, 158, 161
TspRI CASTG 1 cut(s) 142
XbaI TCTAGA 1 cut(s) 94
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.