Rorug01G0280600

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
39402093 .. 39403886
1794 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0280600.1

Sequence Viewer

Length: 237 bp
ATGAACCCACAAGTGGATAAGCTGGTGAGGGGGACTACTATAGTGGCTACTATCACTGCTTCCTATTTTCTCTTAACCGCTGATTATGGTCCTGAGCCCAATGTTCTCGACCCTATTAAGAAGGCAATACAGTCCACAGAAAGCTCTGTCAAAGACTTCATCTTTGGATCAAAGACCCAACCTCCAGAAAGCGAAGTGAAGAAGCTGGACCCTAACAGTGCAAAGGAACATCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.53

Weight (kDa)

5.69

Isoelectric Point (pI)

25.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 78
AclWI GGATC 1 cut(s) 175
AfiI CCNNNNNNNGG 1 cut(s) 13
AluBI AGCT 3 cut(s) 22, 144, 205
AluI AGCT 3 cut(s) 22, 144, 205
AlwI GGATC 1 cut(s) 175
ArsI GACNNNNNNTTYG 2 cut(s) 146, 178
AspS9I GGNCC 2 cut(s) 89, 208
AsuHPI GGTGA 1 cut(s) 37
AvaII GGWCC 2 cut(s) 89, 208
BanII GRGCYC 1 cut(s) 99
BfmI CTRYAG 1 cut(s) 39
Bme18I GGWCC 2 cut(s) 89, 208
BmgT120I GGNCC 2 cut(s) 89, 208
BmiI GGNNCC 1 cut(s) 210
BpmI CTGGAG 1 cut(s) 168
Bpu10I CCTNAGC 1 cut(s) 93
BsaXI ACNNNNNCTCC 2 cut(s) 166, 196
Bsc4I CCNNNNNNNGG 1 cut(s) 13
BseGI GGATG 1 cut(s) 229
BseLI CCNNNNNNNGG 1 cut(s) 13
BseMII CTCAG 1 cut(s) 84
BslFI GGGAC 1 cut(s) 46
BslI CCNNNNNNNGG 1 cut(s) 13
BsmFI GGGAC 1 cut(s) 46
Bsp1286I GDGCHC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 167
BspACI CCGC 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 85
BspLI GGNNCC 1 cut(s) 210
BspPI GGATC 1 cut(s) 175
BssMI GATC 1 cut(s) 167
Bst4CI ACNGT 2 cut(s) 132, 218
BstDEI CTNAG 2 cut(s) 93, 234
BstF5I GGATG 1 cut(s) 229
BstKTI GATC 1 cut(s) 170
BstMBI GATC 1 cut(s) 167
BstSFI CTRYAG 1 cut(s) 39
BtsCI GGATG 1 cut(s) 229
BtsI GCAGTG 1 cut(s) 54
BtsIMutI CAGTG 2 cut(s) 54, 223
Cfr13I GGNCC 2 cut(s) 89, 208
CviJI RGCY 5 cut(s) 22, 47, 97, 144, 205
CviKI_1 RGCY 5 cut(s) 22, 47, 97, 144, 205
DdeI CTNAG 2 cut(s) 93, 234
DpnI GATC 1 cut(s) 169
DpnII GATC 1 cut(s) 167
Eco24I GRGCYC 1 cut(s) 99
Eco47I GGWCC 2 cut(s) 89, 208
EcoT38I GRGCYC 1 cut(s) 99
FaiI YATR 2 cut(s) 41, 87
FaqI GGGAC 1 cut(s) 46
FokI GGATG 1 cut(s) 216
FriOI GRGCYC 1 cut(s) 99
GsuI CTGGAG 1 cut(s) 168
HphI GGTGA 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 135
Hpy188III TCNNGA 3 cut(s) 92, 107, 185
Hpy8I GTNNAC 1 cut(s) 135
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 2 cut(s) 132, 218
HpyCH4V TGCA 1 cut(s) 221
HpyF3I CTNAG 2 cut(s) 93, 234
Kzo9I GATC 1 cut(s) 167
LpnPI CCDG 4 cut(s) 8, 105, 191, 198
MalI GATC 1 cut(s) 169
MboI GATC 1 cut(s) 167
MboII GAAGA 1 cut(s) 211
MhlI GDGCHC 1 cut(s) 99
MnlI CCTC 2 cut(s) 21, 192
MseI TTAA 2 cut(s) 74, 117
MspA1I CMGCKG 1 cut(s) 80
NdeII GATC 1 cut(s) 167
NlaIV GGNNCC 1 cut(s) 210
PspN4I GGNNCC 1 cut(s) 210
PspPI GGNCC 2 cut(s) 89, 208
SaqAI TTAA 2 cut(s) 74, 117
Sau3AI GATC 1 cut(s) 167
Sau96I GGNCC 2 cut(s) 89, 208
SduI GDGCHC 1 cut(s) 99
SetI ASST 4 cut(s) 24, 146, 184, 207
SfcI CTRYAG 1 cut(s) 39
SgeI CNNG 6 cut(s) 23, 35, 104, 119, 197, 218
SinI GGWCC 2 cut(s) 89, 208
SsiI CCGC 1 cut(s) 78
TaaI ACNGT 2 cut(s) 132, 218
TaqI TCGA 1 cut(s) 108
Tru1I TTAA 2 cut(s) 74, 117
Tru9I TTAA 2 cut(s) 74, 117
TscAI CASTG 2 cut(s) 61, 223
TspDTI ATGAA 2 cut(s) 17, 148
TspRI CASTG 2 cut(s) 61, 223
VpaK11BI GGWCC 2 cut(s) 89, 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.