Rorug01G0339000

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
45681933 .. 45682682
750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0339000.1

Sequence Viewer

Length: 360 bp
ATGTTGGGAAGTGAAGGGATTGTAGTGGGGAAGTTGGGGAATGTAGTGGCAGGAAGTGGAGGTAGAGTGAACTTGGGAGCAGTGGGAAGGTTTGGCAATGTTGGATTTGGTAGAGATGGCATTTGGGTGCTTGGCAGAGGTGGGATTTGTGTTGTGGGTTTTGGCAGTGGTGGCAATGGTGGCAGAGGAGTTGGCATAGGCAGTGGAGGCACTGCACCCTTGGGAACTGGAATCAATGGAATTGATGTCTGCAACAGGTGCCTGGCGCCAAAGCTGATGTCAATGCTCGACAAACACAATGCTGCTACCATGATAGATAATAGGGAACAATGCTTGAGGCCTGCCATTTTAGTTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

11.81

Weight (kDa)

9.24

Isoelectric Point (pI)

14.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 258, 265
AcyI GRCGYC 1 cut(s) 266
AgsI TTSAA 1 cut(s) 356
AjnI CCWGG 1 cut(s) 261
AluBI AGCT 1 cut(s) 274
AluI AGCT 1 cut(s) 274
AoxI GGCC 1 cut(s) 338
ApeKI GCWGC 1 cut(s) 302
ArsI GACNNNNNNTTYG 2 cut(s) 263, 295
AspLEI GCGC 1 cut(s) 268
BanI GGYRCC 2 cut(s) 258, 265
BbvI GCAGC 1 cut(s) 289
BccI CCATC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 263
BfoI RGCGCY 1 cut(s) 269
BisI GCNGC 1 cut(s) 303
BlsI GCNGC 1 cut(s) 304
Bme1390I CCNGG 1 cut(s) 263
BmiI GGNNCC 2 cut(s) 260, 267
BmrFI CCNGG 1 cut(s) 263
BpuEI CTTGAG 1 cut(s) 355
BsaHI GRCGYC 1 cut(s) 266
BsaJI CCNNGG 1 cut(s) 219
BsaXI ACNNNNNCTCC 2 cut(s) 51, 81
Bse1I ACTGG 1 cut(s) 232
Bse3DI GCAATG 2 cut(s) 103, 181
BseBI CCWGG 1 cut(s) 263
BseDI CCNNGG 1 cut(s) 219
BseMI GCAATG 2 cut(s) 103, 181
BseNI ACTGG 1 cut(s) 232
BseRI GAGGAG 1 cut(s) 201
BseXI GCAGC 1 cut(s) 289
BsgI GTGCAG 1 cut(s) 198
BshFI GGCC 1 cut(s) 340
BshNI GGYRCC 2 cut(s) 258, 265
BsnI GGCC 1 cut(s) 340
BspANI GGCC 1 cut(s) 340
BspLI GGNNCC 2 cut(s) 260, 267
BspT107I GGYRCC 2 cut(s) 258, 265
BsrDI GCAATG 2 cut(s) 103, 181
BsrI ACTGG 1 cut(s) 232
BssECI CCNNGG 1 cut(s) 219
BssNI GRCGYC 1 cut(s) 266
BssT1I CCWWGG 1 cut(s) 219
Bst2UI CCWGG 1 cut(s) 263
BstACI GRCGYC 1 cut(s) 266
BstAPI GCANNNNNTGC 1 cut(s) 258
BstC8I GCNNGC 1 cut(s) 342
BstH2I RGCGCY 1 cut(s) 269
BstHHI GCGC 1 cut(s) 268
BstMWI GCNNNNNNNGC 4 cut(s) 171, 180, 207, 258
BstNI CCWGG 1 cut(s) 263
BstSCI CCNGG 1 cut(s) 261
BstV1I GCAGC 1 cut(s) 289
BsuRI GGCC 1 cut(s) 340
BtsI GCAGTG 4 cut(s) 87, 172, 208, 210
BtsIMutI CAGTG 4 cut(s) 87, 172, 208, 210
Cac8I GCNNGC 1 cut(s) 342
CfoI GCGC 1 cut(s) 268
CviAII CATG 1 cut(s) 310
CviJI RGCY 2 cut(s) 274, 340
CviKI_1 RGCY 2 cut(s) 274, 340
DinI GGCGCC 1 cut(s) 267
Eco130I CCWWGG 1 cut(s) 219
Eco147I AGGCCT 1 cut(s) 340
EcoRII CCWGG 1 cut(s) 261
EcoT14I CCWWGG 1 cut(s) 219
EgeI GGCGCC 1 cut(s) 267
EheI GGCGCC 1 cut(s) 267
ErhI CCWWGG 1 cut(s) 219
FaeI CATG 1 cut(s) 313
FaiI YATR 2 cut(s) 197, 311
FatI CATG 1 cut(s) 309
Fnu4HI GCNGC 1 cut(s) 303
Fsp4HI GCNGC 1 cut(s) 303
GlaI GCGC 1 cut(s) 267
GluI GCNGC 1 cut(s) 303
HaeII RGCGCY 1 cut(s) 269
HaeIII GGCC 1 cut(s) 340
HhaI GCGC 1 cut(s) 268
Hin1I GRCGYC 1 cut(s) 266
Hin1II CATG 1 cut(s) 313
Hin6I GCGC 1 cut(s) 266
HinP1I GCGC 1 cut(s) 266
HinfI GANTC 1 cut(s) 231
Hpy166II GTNNAC 1 cut(s) 70
Hpy8I GTNNAC 1 cut(s) 70
HpyAV CCTTC 2 cut(s) 8, 81
HpyCH4V TGCA 2 cut(s) 215, 252
HpyF10VI GCNNNNNNNGC 4 cut(s) 171, 180, 207, 258
Hsp92I GRCGYC 1 cut(s) 266
Hsp92II CATG 1 cut(s) 313
HspAI GCGC 1 cut(s) 266
KasI GGCGCC 1 cut(s) 265
LmnI GCTCC 1 cut(s) 77
LpnPI CCDG 6 cut(s) 36, 213, 241, 248, 275, 354
Lsp1109I GCAGC 1 cut(s) 289
MluCI AATT 1 cut(s) 240
Mly113I GGCGCC 1 cut(s) 266
MmeI TCCRAC 1 cut(s) 82
MnlI CCTC 5 cut(s) 53, 131, 179, 200, 330
MslI CAYNNNNRTG 1 cut(s) 125
MspR9I CCNGG 1 cut(s) 263
MvaI CCWGG 1 cut(s) 263
MwoI GCNNNNNNNGC 4 cut(s) 171, 180, 207, 258
NarI GGCGCC 1 cut(s) 266
NlaIII CATG 1 cut(s) 313
NlaIV GGNNCC 2 cut(s) 260, 267
PceI AGGCCT 1 cut(s) 340
PfeI GAWTC 1 cut(s) 231
PkrI GCNGC 1 cut(s) 304
PluTI GGCGCC 1 cut(s) 269
Psp6I CCWGG 1 cut(s) 261
PspGI CCWGG 1 cut(s) 261
PspN4I GGNNCC 2 cut(s) 260, 267
RseI CAYNNNNRTG 1 cut(s) 125
SatI GCNGC 1 cut(s) 303
ScrFI CCNGG 1 cut(s) 263
SetI ASST 5 cut(s) 64, 92, 142, 260, 276
SfoI GGCGCC 1 cut(s) 267
SmiMI CAYNNNNRTG 1 cut(s) 125
SmlI CTYRAG 1 cut(s) 334
SmoI CTYRAG 1 cut(s) 334
Sse9I AATT 1 cut(s) 240
SseBI AGGCCT 1 cut(s) 340
SspDI GGCGCC 1 cut(s) 265
StuI AGGCCT 1 cut(s) 340
StyD4I CCNGG 1 cut(s) 261
StyI CCWWGG 1 cut(s) 219
TaqI TCGA 1 cut(s) 288
TasI AATT 1 cut(s) 240
TfiI GAWTC 1 cut(s) 231
TscAI CASTG 4 cut(s) 87, 172, 208, 217
TseI GCWGC 1 cut(s) 302
TspRI CASTG 4 cut(s) 87, 172, 208, 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.