Rorug02G0179400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0010520
Physical Location & Seq
Reverse (-)
16624047 .. 16624625
579 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0179400.1

Sequence Viewer

Length: 579 bp
ATGACGTCGTCCTCCGCTGCTTCTCGATTGGGTTTGGGGATAAGGACTGCTTCTTCCTCCACCGCCAGCGAAATCATGGAGGCTCGAGGCCATATTCTAAGGGCCACCGGCAGAAAAGACCGCCACGGCAAGGTCTGCACCGCCAAAGGCCCCAGGGACCACTGCGTCCGGCTCGCCGCCCACACCGCCATTCAATTCTACGACGTGCAAGACCGGCTCGGATATGACCGGCCCAGCAAGGCCGTTGATTGGCTCATCAAGAAAACCAAGGCCGCAATCGACGAGCTGCCGCTGTGGAACCCGAACTCAATTTCTGTTCAGACAACATCTTCTCCGACAGTGACGATATCCGCCACGCAGAACGCGAGCCTCCATTTCTCGATGGTGGAGGCTCCGAGTTCTTTGTCTGCTAATCGACGAGGCGCAATGGTGGGTAGCAGCGGAGTGGCGGAGCTGGTGAATCAGAACAACTCGAATTTTCTACATGTGAGGATGGTGTGGAGGTCGAAGTTGTTAATCTTTGTCTGCCTACAATTGCCTCTGATCGAAGTTGGGCTAGAGGCCGAAGTTGTAGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

192

Amino Acids

20.77

Weight (kDa)

9.71

Isoelectric Point (pI)

39.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TCP PF03634 37 - 123 3e-27 TCP family transcription factor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 164
AatII GACGTC 1 cut(s) 8
AccII CGCG 1 cut(s) 365
AcsI RAATTY 1 cut(s) 475
AcyI GRCGYC 1 cut(s) 5
AfiI CCNNNNNNNGG 2 cut(s) 130, 249
AflIII ACRYGT 1 cut(s) 484
AgsI TTSAA 1 cut(s) 194
AjiI CACGTC 1 cut(s) 205
AjnI CCWGG 1 cut(s) 152
AluBI AGCT 2 cut(s) 286, 454
AluI AGCT 2 cut(s) 286, 454
Ama87I CYCGRG 1 cut(s) 84
AoxI GGCC 7 cut(s) 88, 102, 148, 230, 240, 270, 561
ApeKI GCWGC 3 cut(s) 17, 286, 438
ApoI RAATTY 1 cut(s) 475
AspLEI GCGC 1 cut(s) 425
AspS9I GGNCC 4 cut(s) 102, 149, 157, 231
AsuHPI GGTGA 1 cut(s) 469
AvaI CYCGRG 1 cut(s) 84
AvaII GGWCC 1 cut(s) 157
BbvI GCAGC 3 cut(s) 4, 273, 450
BccI CCATC 2 cut(s) 376, 487
BceAI ACGGC 2 cut(s) 142, 227
BciT130I CCWGG 1 cut(s) 154
BfaI CTAG 2 cut(s) 557, 577
BisI GCNGC 6 cut(s) 18, 177, 273, 287, 290, 439
BlsI GCNGC 6 cut(s) 19, 178, 274, 288, 291, 440
Bme1390I CCNGG 1 cut(s) 154
Bme18I GGWCC 1 cut(s) 157
BmeT110I CYCGRG 1 cut(s) 84
BmgBI CACGTC 1 cut(s) 205
BmgT120I GGNCC 4 cut(s) 102, 149, 157, 231
BmiI GGNNCC 4 cut(s) 151, 158, 299, 393
BmrFI CCNGG 1 cut(s) 154
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 4 cut(s) 124, 152, 153, 267
BsaXI ACNNNNNCTCC 2 cut(s) 316, 346
Bsc4I CCNNNNNNNGG 2 cut(s) 130, 249
Bse118I RCCGGY 3 cut(s) 107, 213, 228
Bse3DI GCAATG 1 cut(s) 432
BseBI CCWGG 1 cut(s) 154
BseDI CCNNGG 4 cut(s) 124, 152, 153, 267
BseGI GGATG 1 cut(s) 498
BseLI CCNNNNNNNGG 2 cut(s) 130, 249
BseMI GCAATG 1 cut(s) 432
BseXI GCAGC 3 cut(s) 4, 273, 450
BseYI CCCAGC 1 cut(s) 233
BsgI GTGCAG 1 cut(s) 121
Bsh1236I CGCG 1 cut(s) 365
BshFI GGCC 7 cut(s) 90, 104, 150, 232, 242, 272, 563
BsiHKCI CYCGRG 1 cut(s) 84
BsiSI CCGG 4 cut(s) 108, 169, 214, 229
BslFI GGGAC 1 cut(s) 170
BslI CCNNNNNNNGG 2 cut(s) 130, 249
BsmFI GGGAC 1 cut(s) 170
BsnI GGCC 7 cut(s) 90, 104, 150, 232, 242, 272, 563
BsoBI CYCGRG 1 cut(s) 84
Bsp143I GATC 1 cut(s) 543
BspANI GGCC 7 cut(s) 90, 104, 150, 232, 242, 272, 563
BspFNI CGCG 1 cut(s) 365
BspLI GGNNCC 4 cut(s) 151, 158, 299, 393
BsrDI GCAATG 1 cut(s) 432
BsrFI RCCGGY 3 cut(s) 107, 213, 228
BssAI RCCGGY 3 cut(s) 107, 213, 228
BssECI CCNNGG 4 cut(s) 124, 152, 153, 267
BssMI GATC 1 cut(s) 543
BssNI GRCGYC 1 cut(s) 5
BssT1I CCWWGG 1 cut(s) 267
Bst2UI CCWGG 1 cut(s) 154
Bst4CI ACNGT 1 cut(s) 340
BstACI GRCGYC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 135
BstC8I GCNNGC 3 cut(s) 67, 174, 367
BstDEI CTNAG 1 cut(s) 98
BstDSI CCRYGG 1 cut(s) 124
BstF5I GGATG 1 cut(s) 498
BstFNI CGCG 1 cut(s) 365
BstHHI GCGC 1 cut(s) 425
BstKTI GATC 1 cut(s) 546
BstMBI GATC 1 cut(s) 543
BstMWI GCNNNNNNNGC 3 cut(s) 135, 185, 214
BstNI CCWGG 1 cut(s) 154
BstNSI RCATGY 1 cut(s) 488
BstSCI CCNGG 1 cut(s) 152
BstUI CGCG 1 cut(s) 365
BstV1I GCAGC 3 cut(s) 4, 273, 450
BsuRI GGCC 7 cut(s) 90, 104, 150, 232, 242, 272, 563
BtgI CCRYGG 1 cut(s) 124
BtrI CACGTC 1 cut(s) 205
BtsCI GGATG 1 cut(s) 498
BtsI GCAGTG 1 cut(s) 160
BtsIMutI CAGTG 2 cut(s) 160, 345
Cac8I GCNNGC 3 cut(s) 67, 174, 367
CfoI GCGC 1 cut(s) 425
Cfr10I RCCGGY 3 cut(s) 107, 213, 228
Cfr13I GGNCC 4 cut(s) 102, 149, 157, 231
CseI GACGC 1 cut(s) 154
CviAII CATG 2 cut(s) 76, 485
DdeI CTNAG 1 cut(s) 98
DpnI GATC 1 cut(s) 545
DpnII GATC 1 cut(s) 543
DrdI GACNNNNNNGTC 1 cut(s) 164
DseDI GACNNNNNNGTC 1 cut(s) 164
EciI GGCGGA 2 cut(s) 340, 464
Eco130I CCWWGG 1 cut(s) 267
Eco32I GATATC 1 cut(s) 348
Eco47I GGWCC 1 cut(s) 157
Eco88I CYCGRG 1 cut(s) 84
EcoO109I RGGNCCY 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 152
EcoRV GATATC 1 cut(s) 348
EcoT14I CCWWGG 1 cut(s) 267
ErhI CCWWGG 1 cut(s) 267
FaeI CATG 2 cut(s) 79, 488
FaiI YATR 4 cut(s) 77, 93, 225, 486
FalI AAGNNNNNCTT 2 cut(s) 34, 66
FaqI GGGAC 1 cut(s) 170
FatI CATG 2 cut(s) 75, 484
Fnu4HI GCNGC 6 cut(s) 18, 177, 273, 287, 290, 439
FokI GGATG 1 cut(s) 505
Fsp4HI GCNGC 6 cut(s) 18, 177, 273, 287, 290, 439
FspBI CTAG 2 cut(s) 557, 577
GlaI GCGC 1 cut(s) 424
GluI GCNGC 6 cut(s) 18, 177, 273, 287, 290, 439
GsaI CCCAGC 1 cut(s) 237
HaeIII GGCC 7 cut(s) 90, 104, 150, 232, 242, 272, 563
HapII CCGG 4 cut(s) 108, 169, 214, 229
HgaI GACGC 1 cut(s) 154
HhaI GCGC 1 cut(s) 425
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 2 cut(s) 79, 488
Hin6I GCGC 1 cut(s) 423
HinP1I GCGC 1 cut(s) 423
HinfI GANTC 1 cut(s) 460
HpaII CCGG 4 cut(s) 108, 169, 214, 229
HphI GGTGA 1 cut(s) 469
Hpy188I TCNGA 6 cut(s) 221, 321, 336, 396, 465, 543
Hpy188III TCNNGA 3 cut(s) 24, 259, 379
Hpy99I CGWCG 4 cut(s) 10, 206, 284, 420
HpyCH4III ACNGT 1 cut(s) 340
HpyCH4IV ACGT 2 cut(s) 5, 204
HpyCH4V TGCA 2 cut(s) 138, 208
HpyF10VI GCNNNNNNNGC 3 cut(s) 135, 185, 214
HpyF3I CTNAG 1 cut(s) 98
HpySE526I ACGT 2 cut(s) 5, 204
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 2 cut(s) 79, 488
HspAI GCGC 1 cut(s) 423
Kzo9I GATC 1 cut(s) 543
LmnI GCTCC 2 cut(s) 397, 451
LpnPI CCDG 9 cut(s) 79, 121, 139, 166, 182, 227, 242, 247, 440
Lsp1109I GCAGC 3 cut(s) 4, 273, 450
MaeI CTAG 2 cut(s) 557, 577
MaeII ACGT 2 cut(s) 5, 204
MaeIII GTNAC 1 cut(s) 340
MalI GATC 1 cut(s) 545
MboI GATC 1 cut(s) 543
MboII GAAGA 2 cut(s) 45, 321
MfeI CAATTG 1 cut(s) 533
MluCI AATT 4 cut(s) 194, 309, 475, 533
MmeI TCCRAC 1 cut(s) 359
MseI TTAA 1 cut(s) 515
MspA1I CMGCKG 3 cut(s) 17, 292, 441
MspI CCGG 4 cut(s) 108, 169, 214, 229
MspR9I CCNGG 1 cut(s) 154
MunI CAATTG 1 cut(s) 533
MvaI CCWGG 1 cut(s) 154
MvnI CGCG 1 cut(s) 365
MwoI GCNNNNNNNGC 3 cut(s) 135, 185, 214
NdeII GATC 1 cut(s) 543
NlaIII CATG 2 cut(s) 79, 488
NlaIV GGNNCC 4 cut(s) 151, 158, 299, 393
NmuCI GTSAC 1 cut(s) 340
NspI RCATGY 1 cut(s) 488
PaeR7I CTCGAG 1 cut(s) 84
PasI CCCWGGG 1 cut(s) 153
PciI ACATGT 1 cut(s) 484
PcsI WCGNNNNNNNCGW 1 cut(s) 362
PfeI GAWTC 1 cut(s) 460
PflFI GACNNNGTC 1 cut(s) 7
PkrI GCNGC 6 cut(s) 19, 178, 274, 288, 291, 440
PscI ACATGT 1 cut(s) 484
Psp6I CCWGG 1 cut(s) 152
PspFI CCCAGC 1 cut(s) 233
PspGI CCWGG 1 cut(s) 152
PspN4I GGNNCC 4 cut(s) 151, 158, 299, 393
PspPI GGNCC 4 cut(s) 102, 149, 157, 231
PspXI VCTCGAGB 1 cut(s) 84
PsyI GACNNNGTC 1 cut(s) 7
SaqAI TTAA 1 cut(s) 515
SatI GCNGC 6 cut(s) 18, 177, 273, 287, 290, 439
Sau3AI GATC 1 cut(s) 543
Sau96I GGNCC 4 cut(s) 102, 149, 157, 231
ScrFI CCNGG 1 cut(s) 154
SetI ASST 6 cut(s) 8, 135, 207, 288, 456, 506
Sfr274I CTCGAG 1 cut(s) 84
SinI GGWCC 1 cut(s) 157
SlaI CTCGAG 1 cut(s) 84
SmlI CTYRAG 1 cut(s) 84
SmoI CTYRAG 1 cut(s) 84
Sse9I AATT 4 cut(s) 194, 309, 475, 533
SspMI CTAG 2 cut(s) 557, 577
StyD4I CCNGG 1 cut(s) 152
StyI CCWWGG 1 cut(s) 267
TaaI ACNGT 1 cut(s) 340
TaiI ACGT 2 cut(s) 8, 207
TaqI TCGA 8 cut(s) 25, 85, 279, 380, 415, 473, 506, 546
TasI AATT 4 cut(s) 194, 309, 475, 533
TauI GCSGC 3 cut(s) 179, 275, 292
TfiI GAWTC 1 cut(s) 460
Tru1I TTAA 1 cut(s) 515
Tru9I TTAA 1 cut(s) 515
TscAI CASTG 2 cut(s) 167, 345
TseFI GTSAC 1 cut(s) 340
TseI GCWGC 3 cut(s) 17, 286, 438
Tsp45I GTSAC 1 cut(s) 340
TspRI CASTG 2 cut(s) 167, 345
Tth111I GACNNNGTC 1 cut(s) 7
VpaK11BI GGWCC 1 cut(s) 157
XapI RAATTY 1 cut(s) 475
XceI RCATGY 1 cut(s) 488
XcmI CCANNNNNNNNNTGG 1 cut(s) 73
XhoI CTCGAG 1 cut(s) 84
XspI CTAG 2 cut(s) 557, 577
ZraI GACGTC 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.