Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000002

Orthogroup ID

OG0005875

Physical Location & Seq

Genomic Coordinates Reverse (-)

21365289 .. 21365591

Gene Structure 303 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug02G0220900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

ATGGGTGTAGAGGTTCCATTTGATCTTATCGGCATTCTATATCATCAGCTACAATCTTTTCAAGTTGAAGACATCGAACAAGATTATGAGACCGGTAGAGATGGTATCACCATGGTTACCTTTCAAGTTGATTTTGACCGTGTTGAGAAATTAGAGGATGCTATCAAAAACAACTGTAGCCGGGAGTTGGTGTTCTATGAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ

Protein Analysis

67

Amino Acids

7.88

Weight (kDa)

4.17

Isoelectric Point (pI)

46.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005875)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G18465
fragaria_vesca	FvH4_1g23620 FvH4_1g23620
malus_domestica	MD01G1016700.v1.1
prunus_persica	Prupe.6G131200_v2.0.a1 Prupe.6G131200_v2.0.a1 Prupe.6G131200_v2.0.a1 Prupe.6G131200_v2.0.a1 Prupe.6G131200_v2.0.a1 Prupe.6G162400_v2.0.a1 Prupe.6G162400_v2.0.a1 Prupe.6G162400_v2.0.a1 Prupe.6G162400_v2.0.a1 Prupe.6G162400_v2.0.a1 Prupe.6G162400_v2.0.a1 Prupe.6G162400_v2.0.a1 Prupe.6G162400_v2.0.a1
pyrus_communis	pycom01g02810
rosa_chinensis	RchiOBHm_Chr2g0119201
rosa_laevigata	RLG00000018451
rosa_multiflora	Rmu_sc0000184.1_g000010
rosa_roxburghii	Rroxscaffold_2G00124450
rosa_rugosa	Rorug02G0220900
rosa_samantha	Rh2AG278800 Rh2BG289700 Rh2DG284800 Rh2DG303800
rosa_wichuraiana	Rw2G022160

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	187
AgeI	ACCGGT	1 cut(s)	92
AgsI	TTSAA	3 cut(s)	62, 68, 125
AloI	GAACNNNNNNTCC	1 cut(s)	176
AluBI	AGCT	1 cut(s)	49
AluI	AGCT	1 cut(s)	49
Alw26I	GTCTC	1 cut(s)	83
AsiGI	ACCGGT	1 cut(s)	92
AsuC2I	CCSGG	1 cut(s)	182
AsuHPI	GGTGA	1 cut(s)	100
BbsI	GAAGAC	1 cut(s)	75
BccI	CCATC	1 cut(s)	95
BcnI	CCSGG	1 cut(s)	182
BcoDI	GTCTC	1 cut(s)	83
BfmI	CTRYAG	1 cut(s)	175
Bme1390I	CCNGG	1 cut(s)	182
BmiI	GGNNCC	1 cut(s)	15
BmrFI	CCNGG	1 cut(s)	182
BmsI	GCATC	1 cut(s)	148
BpiI	GAAGAC	1 cut(s)	75
BpuMI	CCSGG	1 cut(s)	182
BsaI	GGTCTC	1 cut(s)	83
BsaJI	CCNNGG	1 cut(s)	111
BsaWI	WCCGGW	1 cut(s)	92
BsaXI	ACNNNNNCTCC	1 cut(s)	176
Bsc4I	CCNNNNNNNGG	1 cut(s)	187
Bse118I	RCCGGY	1 cut(s)	92
BseDI	CCNNGG	1 cut(s)	111
BseGI	GGATG	1 cut(s)	163
BseLI	CCNNNNNNNGG	1 cut(s)	187
BshTI	ACCGGT	1 cut(s)	92
BsiSI	CCGG	2 cut(s)	93, 181
BslI	CCNNNNNNNGG	1 cut(s)	187
BsmAI	GTCTC	1 cut(s)	83
BsmI	GAATGC	1 cut(s)	33
Bso31I	GGTCTC	1 cut(s)	83
Bsp143I	GATC	1 cut(s)	22
Bsp19I	CCATGG	1 cut(s)	111
BspLI	GGNNCC	1 cut(s)	15
BspTNI	GGTCTC	1 cut(s)	83
BsrFI	RCCGGY	1 cut(s)	92
BssAI	RCCGGY	1 cut(s)	92
BssECI	CCNNGG	1 cut(s)	111
BssMI	GATC	1 cut(s)	22
BssT1I	CCWWGG	1 cut(s)	111
Bst4CI	ACNGT	2 cut(s)	140, 176
BstDSI	CCRYGG	1 cut(s)	111
BstEII	GGTNACC	1 cut(s)	115
BstF5I	GGATG	1 cut(s)	163
BstKTI	GATC	1 cut(s)	25
BstMAI	GTCTC	1 cut(s)	83
BstMBI	GATC	1 cut(s)	22
BstPI	GGTNACC	1 cut(s)	115
BstSCI	CCNGG	1 cut(s)	180
BstSFI	CTRYAG	1 cut(s)	175
BstV2I	GAAGAC	1 cut(s)	75
BtgI	CCRYGG	1 cut(s)	111
BtsCI	GGATG	1 cut(s)	163
Cfr10I	RCCGGY	1 cut(s)	92
CspAI	ACCGGT	1 cut(s)	92
CviAII	CATG	1 cut(s)	112
CviJI	RGCY	2 cut(s)	49, 180
CviKI_1	RGCY	2 cut(s)	49, 180
DpnI	GATC	1 cut(s)	24
DpnII	GATC	1 cut(s)	22
Eco130I	CCWWGG	1 cut(s)	111
Eco31I	GGTCTC	1 cut(s)	83
Eco91I	GGTNACC	1 cut(s)	115
EcoO65I	GGTNACC	1 cut(s)	115
EcoT14I	CCWWGG	1 cut(s)	111
ErhI	CCWWGG	1 cut(s)	111
FaeI	CATG	1 cut(s)	115
FaiI	YATR	4 cut(s)	40, 87, 113, 198
FatI	CATG	1 cut(s)	111
FokI	GGATG	1 cut(s)	170
HapII	CCGG	2 cut(s)	93, 181
Hin1II	CATG	1 cut(s)	115
HpaII	CCGG	2 cut(s)	93, 181
HphI	GGTGA	1 cut(s)	100
HpyCH4III	ACNGT	2 cut(s)	140, 176
Hsp92II	CATG	1 cut(s)	115
Kzo9I	GATC	1 cut(s)	22
LpnPI	CCDG	2 cut(s)	106, 194
LweI	GCATC	1 cut(s)	148
MaeIII	GTNAC	1 cut(s)	115
MalI	GATC	1 cut(s)	24
MboI	GATC	1 cut(s)	22
MboII	GAAGA	1 cut(s)	80
MluCI	AATT	1 cut(s)	149
MnlI	CCTC	2 cut(s)	4, 148
MspI	CCGG	2 cut(s)	93, 181
MspR9I	CCNGG	1 cut(s)	182
Mva1269I	GAATGC	1 cut(s)	33
NciI	CCSGG	1 cut(s)	182
NcoI	CCATGG	1 cut(s)	111
NdeII	GATC	1 cut(s)	22
NlaIII	CATG	1 cut(s)	115
NlaIV	GGNNCC	1 cut(s)	15
PctI	GAATGC	1 cut(s)	33
PinAI	ACCGGT	1 cut(s)	92
PspEI	GGTNACC	1 cut(s)	115
PspN4I	GGNNCC	1 cut(s)	15
Sau3AI	GATC	1 cut(s)	22
ScrFI	CCNGG	1 cut(s)	182
SetI	ASST	3 cut(s)	15, 51, 122
SfaNI	GCATC	1 cut(s)	148
SfcI	CTRYAG	1 cut(s)	175
SgeI	CNNG	8 cut(s)	74, 92, 105, 124, 137, 152, 193, 194
Sse9I	AATT	1 cut(s)	149
StyD4I	CCNGG	1 cut(s)	180
StyI	CCWWGG	1 cut(s)	111
TaaI	ACNGT	2 cut(s)	140, 176
TaqI	TCGA	1 cut(s)	75
TasI	AATT	1 cut(s)	149

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.