Rorug02G0450600

Nitrile-specifier protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
57780007 .. 57780162
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0450600.1

Sequence Viewer

Length: 156 bp
ATGGGATATATTGGGGCAAACGGTGTGAATGCTTCGCATAAATACAAGTATAGTGGTGTCAATTTACTATGCCGTGGCCGACTTGCTCTTCCCAAGTTGCTTACAAACAACTCGAATCCCAGCCGGAATATTTCCCTGCTTCTCCTTCCTCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.57

Weight (kDa)

10.63

Isoelectric Point (pI)

25.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 76
AoxI GGCC 1 cut(s) 76
BceAI ACGGC 1 cut(s) 57
BsaJI CCNNGG 2 cut(s) 73, 149
BseDI CCNNGG 2 cut(s) 73, 149
BseYI CCCAGC 1 cut(s) 119
BshFI GGCC 1 cut(s) 78
BsiSI CCGG 1 cut(s) 124
BsmI GAATGC 1 cut(s) 34
BsnI GGCC 1 cut(s) 78
BspANI GGCC 1 cut(s) 78
BspQI GCTCTTC 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 73, 149
Bst4CI ACNGT 1 cut(s) 23
Bst6I CTCTTC 1 cut(s) 93
BstDSI CCRYGG 1 cut(s) 73
BsuRI GGCC 1 cut(s) 78
BtgI CCRYGG 1 cut(s) 73
CspCI CAANNNNNGTGG 2 cut(s) 34, 69
CviJI RGCY 2 cut(s) 78, 123
CviKI_1 RGCY 2 cut(s) 78, 123
EaeI YGGCCR 1 cut(s) 76
Eam1104I CTCTTC 1 cut(s) 93
EarI CTCTTC 1 cut(s) 93
FaiI YATR 4 cut(s) 9, 39, 51, 70
GsaI CCCAGC 1 cut(s) 123
HaeIII GGCC 1 cut(s) 78
HapII CCGG 1 cut(s) 124
HinfI GANTC 1 cut(s) 115
HpaII CCGG 1 cut(s) 124
HpyAV CCTTC 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 23
LguI GCTCTTC 1 cut(s) 93
LpnPI CCDG 3 cut(s) 133, 137, 149
MboII GAAGA 1 cut(s) 80
MluCI AATT 1 cut(s) 61
MspI CCGG 1 cut(s) 124
Mva1269I GAATGC 1 cut(s) 34
PciSI GCTCTTC 1 cut(s) 93
PctI GAATGC 1 cut(s) 34
PfeI GAWTC 1 cut(s) 115
PspFI CCCAGC 1 cut(s) 119
SapI GCTCTTC 1 cut(s) 93
SgeI CNNG 8 cut(s) 58, 86, 95, 106, 124, 132, 136, 148
Sse9I AATT 1 cut(s) 61
SspI AATATT 1 cut(s) 130
TaaI ACNGT 1 cut(s) 23
TaqI TCGA 1 cut(s) 113
TasI AATT 1 cut(s) 61
TfiI GAWTC 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.