Rorug03G0034100

Golgi vesicle prefusion complex stabilization

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0008869
Physical Location & Seq
Reverse (-)
2738951 .. 2740928
1978 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0034100.1

Sequence Viewer

Length: 471 bp
ATGAAACAAGGTGCCAATAAGGGAGATGTTCTAAGTGAAGAACAGATTGCTGAGTTTCAGGACGCTTTCTGTCTGTTTGACAAGGATGGAGATGGATGCATTACAATCGAAGAACTTGCCACCGCAATTAAATCAGTGGATCAAAATCCGACGGCAGAAGAACTGCAGAACATGATAAGCGAAGTTGATATTGACGGCAACGGAACCATAGAATTTGGGGAGTTCCTCAATGTCATGGTGACGAAAATGAAGGAAAATGACGCGGACGAGGAATTGAAAGAAGCTTTCAAAGTGTTCGATAAGGATCAAGATGGCTACATTTCACCTAAAGAGTTGAGGAATGTGATGATTAATCTGGGAGAAAGATTGACAGATGAAGAGGTAGAGCAAATGATCAGAGAAGCTGATTTGGATGGTGATGGCTTAGTCAATTATGAAGAATTTGTGAGAATGATGTTAGCTGCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PPR_3

Protein Analysis

156

Amino Acids

17.59

Weight (kDa)

4.05

Isoelectric Point (pI)

37.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_1 PF00036 18 - 45 4.2e-08 EF hand domain
EF-hand_6 PF13405 18 - 45 2.2e-07 EF-hand domain
EF-hand_7 PF13499 19 - 79 1.8e-14 EF-hand domain pair
EF-hand_9 PF14658 22 - 81 1.1e-07 EF-hand domain
EF-hand_8 PF13833 31 - 80 1.3e-09 EF-hand domain pair
EF-hand_1 PF00036 54 - 80 6.8e-07 EF hand domain
EF-hand_7 PF13499 90 - 152 2.6e-20 EF-hand domain pair
AIF-1 PF21008 90 - 154 4e-06 Allograft inflammatory factor 1
EF-hand_1 PF00036 91 - 118 1.8e-09 EF hand domain
EF-hand_6 PF13405 91 - 120 2e-09 EF-hand domain
EF-hand_5 PF13202 92 - 116 8.2e-08 EF hand
EF-hand_8 PF13833 117 - 152 1e-07 EF-hand domain pair
EF-hand_1 PF00036 127 - 152 2.3e-08 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 11
AccII CGCG 1 cut(s) 263
AciI CCGC 2 cut(s) 123, 263
AclWI GGATC 2 cut(s) 147, 312
AcsI RAATTY 2 cut(s) 212, 440
AgsI TTSAA 2 cut(s) 277, 289
AluBI AGCT 3 cut(s) 284, 404, 461
AluI AGCT 3 cut(s) 284, 404, 461
AlwI GGATC 2 cut(s) 147, 312
ApeKI GCWGC 1 cut(s) 461
ApoI RAATTY 2 cut(s) 212, 440
AseI ATTAAT 1 cut(s) 351
AsuHPI GGTGA 3 cut(s) 250, 315, 428
BanI GGYRCC 1 cut(s) 11
BbvI GCAGC 1 cut(s) 448
BccI CCATC 5 cut(s) 80, 86, 305, 407, 413
BceAI ACGGC 2 cut(s) 168, 211
BcgI CGANNNNNNTGC 4 cut(s) 88, 98, 122, 132
BclI TGATCA 1 cut(s) 393
BfmI CTRYAG 1 cut(s) 164
BisI GCNGC 1 cut(s) 462
BlsI GCNGC 1 cut(s) 463
BmiI GGNNCC 2 cut(s) 13, 205
BmsI GCATC 1 cut(s) 86
BsaBI GATNNNNATC 2 cut(s) 144, 303
Bse8I GATNNNNATC 2 cut(s) 144, 303
BseGI GGATG 3 cut(s) 91, 101, 418
BseJI GATNNNNATC 2 cut(s) 144, 303
BseMII CTCAG 1 cut(s) 42
BseXI GCAGC 1 cut(s) 448
Bsh1236I CGCG 1 cut(s) 263
BshNI GGYRCC 1 cut(s) 11
Bsp143I GATC 3 cut(s) 139, 304, 393
BspACI CCGC 2 cut(s) 123, 263
BspCNI CTCAG 1 cut(s) 43
BspFNI CGCG 1 cut(s) 263
BspLI GGNNCC 2 cut(s) 13, 205
BspMAI CTGCAG 1 cut(s) 168
BspPI GGATC 2 cut(s) 147, 312
BspT107I GGYRCC 1 cut(s) 11
BssMI GATC 3 cut(s) 139, 304, 393
Bst6I CTCTTC 1 cut(s) 372
BstDEI CTNAG 3 cut(s) 32, 51, 424
BstF5I GGATG 3 cut(s) 91, 101, 418
BstFNI CGCG 1 cut(s) 263
BstKTI GATC 3 cut(s) 142, 307, 396
BstMBI GATC 3 cut(s) 139, 304, 393
BstSFI CTRYAG 1 cut(s) 164
BstUI CGCG 1 cut(s) 263
BstV1I GCAGC 1 cut(s) 448
BtsCI GGATG 3 cut(s) 91, 101, 418
BtsIMutI CAGTG 1 cut(s) 141
CseI GACGC 2 cut(s) 71, 269
CviAII CATG 2 cut(s) 172, 235
CviJI RGCY 5 cut(s) 284, 315, 404, 423, 461
CviKI_1 RGCY 5 cut(s) 284, 315, 404, 423, 461
DdeI CTNAG 3 cut(s) 32, 51, 424
DpnI GATC 3 cut(s) 141, 306, 395
DpnII GATC 3 cut(s) 139, 304, 393
Eam1104I CTCTTC 1 cut(s) 372
EarI CTCTTC 1 cut(s) 372
EcoT22I ATGCAT 1 cut(s) 101
FaeI CATG 2 cut(s) 175, 238
FaiI YATR 4 cut(s) 173, 209, 236, 435
FatI CATG 2 cut(s) 171, 234
FbaI TGATCA 1 cut(s) 393
Fnu4HI GCNGC 1 cut(s) 462
FokI GGATG 3 cut(s) 98, 108, 425
Fsp4HI GCNGC 1 cut(s) 462
GluI GCNGC 1 cut(s) 462
HgaI GACGC 2 cut(s) 71, 269
Hin1II CATG 2 cut(s) 175, 238
HindIII AAGCTT 1 cut(s) 282
HphI GGTGA 3 cut(s) 250, 315, 428
Hpy188I TCNGA 2 cut(s) 150, 398
Hpy188III TCNNGA 2 cut(s) 59, 308
Hpy99I CGWCG 1 cut(s) 154
HpyAV CCTTC 1 cut(s) 244
HpyCH4V TGCA 2 cut(s) 99, 166
HpyF3I CTNAG 3 cut(s) 32, 51, 424
Hsp92II CATG 2 cut(s) 175, 238
Ksp22I TGATCA 1 cut(s) 393
Kzo9I GATC 3 cut(s) 139, 304, 393
LpnPI CCDG 2 cut(s) 44, 341
Lsp1109I GCAGC 1 cut(s) 448
LweI GCATC 1 cut(s) 86
MaeIII GTNAC 1 cut(s) 238
MalI GATC 3 cut(s) 141, 306, 395
MboI GATC 3 cut(s) 139, 304, 393
MboII GAAGA 5 cut(s) 50, 122, 170, 389, 449
MluCI AATT 5 cut(s) 126, 212, 272, 430, 440
MmeI TCCRAC 1 cut(s) 173
MnlI CCTC 4 cut(s) 236, 262, 330, 373
Mph1103I ATGCAT 1 cut(s) 101
MseI TTAA 2 cut(s) 129, 351
MvnI CGCG 1 cut(s) 263
NdeII GATC 3 cut(s) 139, 304, 393
NlaIII CATG 2 cut(s) 175, 238
NlaIV GGNNCC 2 cut(s) 13, 205
NmuCI GTSAC 1 cut(s) 238
NsiI ATGCAT 1 cut(s) 101
PkrI GCNGC 1 cut(s) 463
PshBI ATTAAT 1 cut(s) 351
PspN4I GGNNCC 2 cut(s) 13, 205
PstI CTGCAG 1 cut(s) 168
SaqAI TTAA 2 cut(s) 129, 351
SatI GCNGC 1 cut(s) 462
Sau3AI GATC 3 cut(s) 139, 304, 393
SetI ASST 6 cut(s) 13, 286, 328, 384, 406, 463
SfaNI GCATC 1 cut(s) 86
SfcI CTRYAG 1 cut(s) 164
Sse9I AATT 5 cut(s) 126, 212, 272, 430, 440
SsiI CCGC 2 cut(s) 123, 263
TaqI TCGA 2 cut(s) 108, 297
TasI AATT 5 cut(s) 126, 212, 272, 430, 440
Tru1I TTAA 2 cut(s) 129, 351
Tru9I TTAA 2 cut(s) 129, 351
TscAI CASTG 1 cut(s) 141
TseFI GTSAC 1 cut(s) 238
TseI GCWGC 1 cut(s) 461
Tsp45I GTSAC 1 cut(s) 238
TspDTI ATGAA 4 cut(s) 17, 263, 390, 450
TspGWI ACGGA 1 cut(s) 216
TspRI CASTG 1 cut(s) 141
VspI ATTAAT 1 cut(s) 351
XapI RAATTY 2 cut(s) 212, 440
Zsp2I ATGCAT 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.