Rorug04G0033000

Yip1 domain

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
4875517 .. 4875711
195 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0033000.1

Sequence Viewer

Length: 195 bp
ATGATGATGAGAGGCATGACAGCAAACAATTTTGACCCCATTAGATATTCTGGTAGGTGGTATGAAGTTGCTTCACTTAAACGTGGATTTGCTGGGCAAGGTCAGGAAGACTGTCATTGCACCCAGGTAAATGGAAATGGTATGTCTAGTTGTGAACTGATAAATGTGATGTTGAAATCTTGTTTTTGGAAATAA

Protein Analysis

64

Amino Acids

7.29

Weight (kDa)

8.46

Isoelectric Point (pI)

41.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 175
AjnI CCWGG 1 cut(s) 123
BbsI GAAGAC 1 cut(s) 114
BciT130I CCWGG 1 cut(s) 125
BfaI CTAG 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 125
BpiI GAAGAC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 123
Bse3DI GCAATG 1 cut(s) 115
BseBI CCWGG 1 cut(s) 125
BseDI CCNNGG 1 cut(s) 123
BseMI GCAATG 1 cut(s) 115
BseYI CCCAGC 1 cut(s) 92
BsrDI GCAATG 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 123
Bst2UI CCWGG 1 cut(s) 125
Bst4CI ACNGT 1 cut(s) 113
BstNI CCWGG 1 cut(s) 125
BstSCI CCNGG 1 cut(s) 123
BstV2I GAAGAC 1 cut(s) 114
BstXI CCANNNNNNTGG 1 cut(s) 131
CviAII CATG 1 cut(s) 16
EcoRII CCWGG 1 cut(s) 123
FaeI CATG 1 cut(s) 19
FaiI YATR 3 cut(s) 17, 63, 143
FatI CATG 1 cut(s) 15
FspBI CTAG 1 cut(s) 147
GsaI CCCAGC 1 cut(s) 96
Hin1II CATG 1 cut(s) 19
Hpy166II GTNNAC 1 cut(s) 155
Hpy188III TCNNGA 1 cut(s) 104
Hpy8I GTNNAC 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4IV ACGT 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 120
HpySE526I ACGT 1 cut(s) 82
Hsp92II CATG 1 cut(s) 19
LpnPI CCDG 5 cut(s) 36, 78, 89, 110, 137
MaeI CTAG 1 cut(s) 147
MaeII ACGT 1 cut(s) 82
MboII GAAGA 1 cut(s) 119
MluCI AATT 1 cut(s) 28
MnlI CCTC 1 cut(s) 5
MseI TTAA 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 125
MvaI CCWGG 1 cut(s) 125
NlaIII CATG 1 cut(s) 19
Psp6I CCWGG 1 cut(s) 123
PspFI CCCAGC 1 cut(s) 92
PspGI CCWGG 1 cut(s) 123
SaqAI TTAA 1 cut(s) 78
ScrFI CCNGG 1 cut(s) 125
SetI ASST 4 cut(s) 59, 85, 103, 129
SgeI CNNG 9 cut(s) 28, 63, 95, 105, 110, 116, 136, 137, 159
Sse9I AATT 1 cut(s) 28
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 123
TaaI ACNGT 1 cut(s) 113
TaiI ACGT 1 cut(s) 85
TasI AATT 1 cut(s) 28
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TspDTI ATGAA 1 cut(s) 78
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.