Rorug04G0054300

5'-nucleotidase domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
8545019 .. 8545979
961 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0054300.1

Sequence Viewer

Length: 333 bp
ATGCAATCATATATTGGTGTCTTAGCTTGCAAAAAAATACCAATCATAAGGACAACTTGGAGGACCAGCAAAAGCATACCTGGATGTGTCACGACTGAGGAAAAAGAGAAAATCTTGTTACGTGTGCAGTCAGAATTGTGTTTGTGTACACAGGGGGCATTTGAGATTGGTCCTGAAAAGAGGAAAATTGTACTGGAATCAGCTTCATCAAAATGGAGGGAGTTCAAGTCCCGGCTTACAAGGCATTACATTATGCCTTACTTGGATGACCCTGAATCCTTAAAGTTTCCTCCAGATGATTATAGATTCATCAACAAAGATCATTGGACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.92

Weight (kDa)

9.12

Isoelectric Point (pI)

52.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 148, 192
AflIII ACRYGT 1 cut(s) 121
AgsI TTSAA 1 cut(s) 226
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 2 cut(s) 26, 203
AluI AGCT 2 cut(s) 26, 203
AspS9I GGNCC 3 cut(s) 63, 170, 327
AsuC2I CCSGG 1 cut(s) 232
AvaII GGWCC 3 cut(s) 63, 170, 327
BciT130I CCWGG 1 cut(s) 81
BcnI CCSGG 1 cut(s) 232
Bme1390I CCNGG 2 cut(s) 81, 232
Bme18I GGWCC 3 cut(s) 63, 170, 327
BmgT120I GGNCC 3 cut(s) 63, 170, 327
BmrFI CCNGG 2 cut(s) 81, 232
BpmI CTGGAG 1 cut(s) 276
BpuMI CCSGG 1 cut(s) 232
BsaAI YACGTR 1 cut(s) 122
BsaXI ACNNNNNCTCC 2 cut(s) 212, 242
Bse1I ACTGG 1 cut(s) 198
BseBI CCWGG 1 cut(s) 81
BseGI GGATG 2 cut(s) 89, 271
BseMII CTCAG 1 cut(s) 87
BseNI ACTGG 1 cut(s) 198
BsgI GTGCAG 1 cut(s) 146
BsiSI CCGG 1 cut(s) 232
BslFI GGGAC 1 cut(s) 214
BsmFI GGGAC 1 cut(s) 214
Bsp1407I TGTACA 1 cut(s) 146
Bsp143I GATC 1 cut(s) 319
BspCNI CTCAG 1 cut(s) 88
BsrGI TGTACA 1 cut(s) 146
BsrI ACTGG 1 cut(s) 198
BssMI GATC 1 cut(s) 319
Bst2UI CCWGG 1 cut(s) 81
BstAUI TGTACA 1 cut(s) 146
BstBAI YACGTR 1 cut(s) 122
BstC8I GCNNGC 1 cut(s) 28
BstDEI CTNAG 2 cut(s) 22, 96
BstF5I GGATG 2 cut(s) 89, 271
BstKTI GATC 1 cut(s) 322
BstMBI GATC 1 cut(s) 319
BstMWI GCNNNNNNNGC 1 cut(s) 241
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 2 cut(s) 79, 230
BtsCI GGATG 2 cut(s) 89, 271
Cac8I GCNNGC 1 cut(s) 28
Cfr13I GGNCC 3 cut(s) 63, 170, 327
Csp6I GTAC 2 cut(s) 147, 191
CviJI RGCY 3 cut(s) 26, 203, 235
CviKI_1 RGCY 3 cut(s) 26, 203, 235
CviQI GTAC 2 cut(s) 147, 191
DdeI CTNAG 2 cut(s) 22, 96
DpnI GATC 1 cut(s) 321
DpnII GATC 1 cut(s) 319
Eco47I GGWCC 3 cut(s) 63, 170, 327
EcoRII CCWGG 1 cut(s) 79
FaiI YATR 6 cut(s) 10, 12, 47, 77, 254, 303
FalI AAGNNNNNCTT 2 cut(s) 40, 72
FaqI GGGAC 1 cut(s) 214
FokI GGATG 2 cut(s) 96, 278
GsuI CTGGAG 1 cut(s) 276
HapII CCGG 1 cut(s) 232
HinfI GANTC 3 cut(s) 197, 275, 306
HpaII CCGG 1 cut(s) 232
Hpy166II GTNNAC 2 cut(s) 147, 149
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 3 cut(s) 91, 173, 293
Hpy8I GTNNAC 2 cut(s) 147, 149
HpyCH4IV ACGT 1 cut(s) 121
HpyCH4V TGCA 3 cut(s) 4, 30, 127
HpyF10VI GCNNNNNNNGC 1 cut(s) 241
HpyF3I CTNAG 2 cut(s) 22, 96
HpySE526I ACGT 1 cut(s) 121
Kzo9I GATC 1 cut(s) 319
LpnPI CCDG 9 cut(s) 66, 79, 93, 137, 179, 186, 245, 285, 306
MaeII ACGT 1 cut(s) 121
MaeIII GTNAC 2 cut(s) 88, 117
MalI GATC 1 cut(s) 321
MboI GATC 1 cut(s) 319
MluCI AATT 2 cut(s) 134, 186
MnlI CCTC 5 cut(s) 54, 91, 174, 210, 300
MseI TTAA 1 cut(s) 281
MslI CAYNNNNRTG 1 cut(s) 211
MspI CCGG 1 cut(s) 232
MspR9I CCNGG 2 cut(s) 81, 232
MvaI CCWGG 1 cut(s) 81
MwoI GCNNNNNNNGC 1 cut(s) 241
NciI CCSGG 1 cut(s) 232
NdeII GATC 1 cut(s) 319
NmuCI GTSAC 1 cut(s) 88
PfeI GAWTC 3 cut(s) 197, 275, 306
Ppu21I YACGTR 1 cut(s) 122
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PspPI GGNCC 3 cut(s) 63, 170, 327
RsaI GTAC 2 cut(s) 148, 192
RsaNI GTAC 2 cut(s) 147, 191
RseI CAYNNNNRTG 1 cut(s) 211
SaqAI TTAA 1 cut(s) 281
Sau3AI GATC 1 cut(s) 319
Sau96I GGNCC 3 cut(s) 63, 170, 327
ScrFI CCNGG 2 cut(s) 81, 232
SetI ASST 5 cut(s) 28, 82, 124, 205, 332
SinI GGWCC 3 cut(s) 63, 170, 327
SmiMI CAYNNNNRTG 1 cut(s) 211
Sse9I AATT 2 cut(s) 134, 186
StyD4I CCNGG 2 cut(s) 79, 230
TaiI ACGT 1 cut(s) 124
TasI AATT 2 cut(s) 134, 186
TatI WGTACW 2 cut(s) 146, 190
TfiI GAWTC 3 cut(s) 197, 275, 306
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
TspDTI ATGAA 2 cut(s) 195, 298
VpaK11BI GGWCC 3 cut(s) 63, 170, 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.