Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000004

Orthogroup ID

OG0013773

Physical Location & Seq

Genomic Coordinates Reverse (-)

46220662 .. 46221201

Gene Structure 540 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug04G0289000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 294 bp

ATGATCAGGACTATACCTGTGATCGTCGGCTGCTTTCTGTTAATATTGGCCTTTCTGGACGCTGATGTTTTGCAAGATAAACGTCACTTGGCTCAAGTCAAGAACGATCCGATACAGGGAAAAATCATTGAGGATCTTGCTAAGCATGATGATGATGCTTCGATCACAAACAGCCATGATGAAGATGATGATGCTCCGATCATGACAAACAACCATGATGATGATGAAGATGGTCCTTACTATACGGACCGTAGATTTAGACCCCATTATATCAACCCCTCTAAGCATGATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006091 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0009507 GO:0009534 GO:0009536 GO:0009543 GO:0009579 GO:0009765 GO:0009987 GO:0010206 GO:0015979 GO:0016787 GO:0019538 GO:0019684 GO:0030091 GO:0031976 GO:0031977 GO:0031978 GO:0031984 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PDZ_2 Trypsin_2

Protein Analysis

97

Amino Acids

11.14

Weight (kDa)

4.64

Isoelectric Point (pI)

40.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013773)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000017291
rosa_rugosa	Rorug04G0289000 Rorug06G0268400
rosa_samantha	Rh1AG078100 Rh1BG008500 Rh1CG013500 Rh2AG169000 Rh2AG169100 Rh2AG169500 Rh2AG169600 Rh2BG419300 Rh2CG174800 Rh2CG175000 Rh2CG175100 Rh2DG174500 Rh2DG175000 Rh3DG074800
rosa_wichuraiana	Rw2G013260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	101, 141
AfiI	CCNNNNNNNGG	1 cut(s)	116
AlwI	GGATC	2 cut(s)	101, 141
AoxI	GGCC	1 cut(s)	48
ApeKI	GCWGC	1 cut(s)	30
AspS9I	GGNCC	2 cut(s)	233, 247
AvaII	GGWCC	2 cut(s)	233, 247
BbvI	GCAGC	1 cut(s)	17
BccI	CCATC	1 cut(s)	224
BclI	TGATCA	1 cut(s)	3
BisI	GCNGC	1 cut(s)	31
BlpI	GCTNAGC	1 cut(s)	141
BlsI	GCNGC	1 cut(s)	32
Bme18I	GGWCC	2 cut(s)	233, 247
BmgT120I	GGNCC	2 cut(s)	233, 247
BmsI	GCATC	2 cut(s)	145, 181
Bpu1102I	GCTNAGC	1 cut(s)	141
BpuEI	CTTGAG	1 cut(s)	78
Bsc4I	CCNNNNNNNGG	1 cut(s)	116
BseLI	CCNNNNNNNGG	1 cut(s)	116
BseXI	GCAGC	1 cut(s)	17
BshFI	GGCC	1 cut(s)	50
BslI	CCNNNNNNNGG	1 cut(s)	116
BsnI	GGCC	1 cut(s)	50
Bsp143I	GATC	6 cut(s)	3, 21, 106, 133, 162, 198
Bsp1720I	GCTNAGC	1 cut(s)	141
BspANI	GGCC	1 cut(s)	50
BspHI	TCATGA	1 cut(s)	201
BspPI	GGATC	2 cut(s)	101, 141
BssMI	GATC	6 cut(s)	3, 21, 106, 133, 162, 198
Bst4CI	ACNGT	1 cut(s)	251
BstDEI	CTNAG	2 cut(s)	141, 282
BstKTI	GATC	6 cut(s)	6, 24, 109, 136, 165, 201
BstMBI	GATC	6 cut(s)	3, 21, 106, 133, 162, 198
BstV1I	GCAGC	1 cut(s)	17
BstX2I	RGATCY	1 cut(s)	133
BstYI	RGATCY	1 cut(s)	133
BsuRI	GGCC	1 cut(s)	50
CciI	TCATGA	1 cut(s)	201
Cfr13I	GGNCC	2 cut(s)	233, 247
CpoI	CGGWCCG	1 cut(s)	247
CseI	GACGC	1 cut(s)	68
CspI	CGGWCCG	1 cut(s)	247
CviAII	CATG	5 cut(s)	146, 176, 202, 215, 287
CviJI	RGCY	4 cut(s)	30, 50, 92, 174
CviKI_1	RGCY	4 cut(s)	30, 50, 92, 174
DdeI	CTNAG	2 cut(s)	141, 282
DpnI	GATC	6 cut(s)	5, 23, 108, 135, 164, 200
DpnII	GATC	6 cut(s)	3, 21, 106, 133, 162, 198
Eco47I	GGWCC	2 cut(s)	233, 247
FaeI	CATG	5 cut(s)	149, 179, 205, 218, 290
FaiI	YATR	8 cut(s)	14, 147, 177, 203, 216, 243, 270, 288
FatI	CATG	5 cut(s)	145, 175, 201, 214, 286
FbaI	TGATCA	1 cut(s)	3
Fnu4HI	GCNGC	1 cut(s)	31
Fsp4HI	GCNGC	1 cut(s)	31
GluI	GCNGC	1 cut(s)	31
HaeIII	GGCC	1 cut(s)	50
HgaI	GACGC	1 cut(s)	68
Hin1II	CATG	5 cut(s)	149, 179, 205, 218, 290
Hpy188I	TCNGA	2 cut(s)	111, 198
Hpy188III	TCNNGA	4 cut(s)	7, 56, 100, 202
Hpy99I	CGWCG	1 cut(s)	29
HpyCH4III	ACNGT	1 cut(s)	251
HpyCH4IV	ACGT	1 cut(s)	82
HpyCH4V	TGCA	1 cut(s)	73
HpyF3I	CTNAG	2 cut(s)	141, 282
HpySE526I	ACGT	1 cut(s)	82
Hsp92II	CATG	5 cut(s)	149, 179, 205, 218, 290
Ksp22I	TGATCA	1 cut(s)	3
Kzo9I	GATC	6 cut(s)	3, 21, 106, 133, 162, 198
LmnI	GCTCC	1 cut(s)	199
LpnPI	CCDG	3 cut(s)	30, 41, 101
Lsp1109I	GCAGC	1 cut(s)	17
LweI	GCATC	2 cut(s)	145, 181
MaeII	ACGT	1 cut(s)	82
MaeIII	GTNAC	1 cut(s)	83
MalI	GATC	6 cut(s)	5, 23, 108, 135, 164, 200
MboI	GATC	6 cut(s)	3, 21, 106, 133, 162, 198
MboII	GAAGA	2 cut(s)	194, 239
MflI	RGATCY	1 cut(s)	133
MnlI	CCTC	2 cut(s)	124, 289
MseI	TTAA	1 cut(s)	41
MslI	CAYNNNNRTG	2 cut(s)	150, 219
NdeII	GATC	6 cut(s)	3, 21, 106, 133, 162, 198
NlaIII	CATG	5 cut(s)	149, 179, 205, 218, 290
NmuCI	GTSAC	1 cut(s)	83
PagI	TCATGA	1 cut(s)	201
PkrI	GCNGC	1 cut(s)	32
PspPI	GGNCC	2 cut(s)	233, 247
PsuI	RGATCY	1 cut(s)	133
RseI	CAYNNNNRTG	2 cut(s)	150, 219
Rsr2I	CGGWCCG	1 cut(s)	247
RsrII	CGGWCCG	1 cut(s)	247
SaqAI	TTAA	1 cut(s)	41
SatI	GCNGC	1 cut(s)	31
Sau3AI	GATC	6 cut(s)	3, 21, 106, 133, 162, 198
Sau96I	GGNCC	2 cut(s)	233, 247
SetI	ASST	2 cut(s)	19, 85
SfaNI	GCATC	2 cut(s)	145, 181
SinI	GGWCC	2 cut(s)	233, 247
SmiMI	CAYNNNNRTG	2 cut(s)	150, 219
SmlI	CTYRAG	1 cut(s)	93
SmoI	CTYRAG	1 cut(s)	93
SspI	AATATT	1 cut(s)	45
TaaI	ACNGT	1 cut(s)	251
TaiI	ACGT	1 cut(s)	85
TaqI	TCGA	1 cut(s)	161
Tru1I	TTAA	1 cut(s)	41
Tru9I	TTAA	1 cut(s)	41
TseFI	GTSAC	1 cut(s)	83
TseI	GCWGC	1 cut(s)	30
Tsp45I	GTSAC	1 cut(s)	83
TspDTI	ATGAA	2 cut(s)	195, 240
TspGWI	ACGGA	1 cut(s)	260
VpaK11BI	GGWCC	2 cut(s)	233, 247

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.