Rh1AG078100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
13056859 .. 13058999
2141 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG078100.1

Sequence Viewer

Length: 183 bp
ATGCCATCTCACCTGACGGACAGACAATTGTCATGGGAGCAGGAGATGAAACACTTAGGTTTTGGAATGTACATCTACAATTACTCAGTGGCTCAAAGTGGTACTCAAAGATTGATAGAAGCTAACCATTTGACCGATGCAATACCGTGCTCCATTGATAAGGAAATGGAGTTCCATCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

7.01

Weight (kDa)

5.33

Isoelectric Point (pI)

41.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 71, 103
AloI GAACNNNNNNTCC 1 cut(s) 155
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
Alw21I GWGCWC 1 cut(s) 152
Bbv12I GWGCWC 1 cut(s) 152
BccI CCATC 1 cut(s) 13
BfmI CTRYAG 1 cut(s) 179
BmsI GCATC 1 cut(s) 127
BoxI GACNNNNGTC 1 cut(s) 28
BseMII CTCAG 1 cut(s) 99
BsiHKAI GWGCWC 1 cut(s) 152
Bsp1286I GDGCHC 1 cut(s) 152
Bsp1407I TGTACA 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 98
BsrGI TGTACA 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 147
BstAUI TGTACA 1 cut(s) 69
BstDEI CTNAG 2 cut(s) 55, 85
BstPAI GACNNNNGTC 1 cut(s) 28
BstSFI CTRYAG 1 cut(s) 179
BtsIMutI CAGTG 1 cut(s) 93
Csp6I GTAC 2 cut(s) 70, 102
CviAII CATG 1 cut(s) 33
CviJI RGCY 2 cut(s) 92, 122
CviKI_1 RGCY 2 cut(s) 92, 122
CviQI GTAC 2 cut(s) 70, 102
DdeI CTNAG 2 cut(s) 55, 85
FaeI CATG 1 cut(s) 36
FaiI YATR 2 cut(s) 34, 181
FatI CATG 1 cut(s) 32
Hin1II CATG 1 cut(s) 36
HpyCH4III ACNGT 1 cut(s) 147
HpyCH4V TGCA 1 cut(s) 140
HpyF3I CTNAG 2 cut(s) 55, 85
Hsp92II CATG 1 cut(s) 36
LmnI GCTCC 2 cut(s) 37, 155
LpnPI CCDG 2 cut(s) 26, 26
LweI GCATC 1 cut(s) 127
MfeI CAATTG 1 cut(s) 26
MhlI GDGCHC 1 cut(s) 152
MluCI AATT 2 cut(s) 26, 79
MunI CAATTG 1 cut(s) 26
NlaIII CATG 1 cut(s) 36
PshAI GACNNNNGTC 1 cut(s) 28
RsaI GTAC 2 cut(s) 71, 103
RsaNI GTAC 2 cut(s) 70, 102
SduI GDGCHC 1 cut(s) 152
SetI ASST 3 cut(s) 15, 61, 124
SfaNI GCATC 1 cut(s) 127
SfcI CTRYAG 1 cut(s) 179
SgeI CNNG 4 cut(s) 25, 45, 53, 159
Sse9I AATT 2 cut(s) 26, 79
TaaI ACNGT 1 cut(s) 147
TaqII GACCGA 1 cut(s) 149
TasI AATT 2 cut(s) 26, 79
TatI WGTACW 1 cut(s) 69
TscAI CASTG 1 cut(s) 93
TspDTI ATGAA 1 cut(s) 62
TspGWI ACGGA 1 cut(s) 32
TspRI CASTG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.