Rh3DG074800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
5377698 .. 5378631
934 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG074800.1

Sequence Viewer

Length: 237 bp
ATGGTGAGTCTGGAAGTGGTGGATACAGGAGTAGTTTGGGATAAACAAGGACACATTGTAACAAATTATCATTATCATGATTTCAGTTTCATGCAACCAAGATATGTCTTTGCTTTCAAGTTCAGTTTCATGCCATCTCACCTGACGGACAGACAATTGTCACGGGAGCAGGAGATGAAACACTTAGGTTTTGGAATGTGTTTCCTTCCCCGAAATGCAAGATTTAATAGATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

9.37

Weight (kDa)

8.98

Isoelectric Point (pI)

33.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 118
AsuHPI GGTGA 2 cut(s) 16, 131
BaeI ACNNNNGTAYC 2 cut(s) 15, 48
BccI CCATC 1 cut(s) 142
BciVI GTATCC 1 cut(s) 16
BfuI GTATCC 1 cut(s) 16
BoxI GACNNNNGTC 1 cut(s) 157
BspHI TCATGA 1 cut(s) 76
BstDEI CTNAG 1 cut(s) 184
BstPAI GACNNNNGTC 1 cut(s) 157
BsuI GTATCC 1 cut(s) 16
CciI TCATGA 1 cut(s) 76
CviAII CATG 3 cut(s) 77, 91, 130
DdeI CTNAG 1 cut(s) 184
FaeI CATG 3 cut(s) 80, 94, 133
FaiI YATR 5 cut(s) 78, 92, 105, 131, 235
FatI CATG 3 cut(s) 76, 90, 129
Hin1II CATG 3 cut(s) 80, 94, 133
HinfI GANTC 1 cut(s) 7
HphI GGTGA 2 cut(s) 16, 131
Hpy188III TCNNGA 2 cut(s) 11, 77
HpyAV CCTTC 1 cut(s) 215
HpyCH4V TGCA 2 cut(s) 94, 218
HpyF3I CTNAG 1 cut(s) 184
Hsp92II CATG 3 cut(s) 80, 94, 133
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 3 cut(s) 12, 155, 155
MaeIII GTNAC 2 cut(s) 58, 159
MfeI CAATTG 1 cut(s) 155
MluCI AATT 2 cut(s) 64, 155
MlyI GAGTC 1 cut(s) 16
MseI TTAA 1 cut(s) 225
MslI CAYNNNNRTG 1 cut(s) 75
MunI CAATTG 1 cut(s) 155
NlaIII CATG 3 cut(s) 80, 94, 133
NmuCI GTSAC 1 cut(s) 159
PagI TCATGA 1 cut(s) 76
PleI GAGTC 1 cut(s) 15
PpsI GAGTC 1 cut(s) 15
PshAI GACNNNNGTC 1 cut(s) 157
RseI CAYNNNNRTG 1 cut(s) 75
SaqAI TTAA 1 cut(s) 225
SchI GAGTC 1 cut(s) 16
SetI ASST 2 cut(s) 144, 190
SmiMI CAYNNNNRTG 1 cut(s) 75
Sse9I AATT 2 cut(s) 64, 155
TasI AATT 2 cut(s) 64, 155
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TseFI GTSAC 1 cut(s) 159
Tsp45I GTSAC 1 cut(s) 159
TspDTI ATGAA 3 cut(s) 79, 118, 191
TspGWI ACGGA 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.