Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000005

Orthogroup ID

OG0003236

Physical Location & Seq

Genomic Coordinates Forward (+)

23612878 .. 23615109

Gene Structure 2232 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug05G0227200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1017 bp

ATGGTTGCCAACAATAACTCTTTAATCAGTACAATCTCCTTAGCCTCGACAATAACGAGATCATTATGTTTCTTGTTTCTGTTAATACGATCTGCAACTCCATTGAACTTTACTTTCTCCACTTTTCCCAACACTATTAACACTCTGTCGCTAGAGGGAGACGCTTCTATCGAAGGTCAATTCCTTCGCCTCACCCTAAGCGCCCAAGATGAATCGATGAACGTGAGTATCGGTCGGGCCACCTACAGTCAACCCTTCCTCCTCCGTGAAAACGCCACCGGAAAACTGGCCGACTTCACCACCACTTTCACATTTGTCATCAATTCTCAAAACATGCCCCACTACGCGGATGGTCTTGCCTTCGATCTTCCTTGGCCCAAATGGACTGAGTATCCGTTTGTGGCGATTGGATTTGATATCTACCGGAACACTGCAGAAAGCGTTGATGATCCGGTAGGCGATCATGTTGGAATTGACGTCAACGCTCTCAAGTCCTTGACCACCACACCTTGGCACGGTGGTATTGAGGAAGGAAAACTCAATAGTGCTACGAATCAGTACTTGCCGGATTGCGTCATTGTTCGGATCGGATCCGGCTCCTCTAAAGTTCGGAGGACCCTTAGATTAGACAGATGGTTAAGATTTTATGAAATTGACGTAAATTTACAACCTCCTCACTTTAGAGGAGCCAGATCCGTTGGGATCTCTGGTGCAACAGGAAATGAAATTGCATTACATAAGATCAGCTCATGGAATTTTACTTCAACTCTCCTGGCTGATGAGATTACAGCTAAGAAATCTGCAAGTCCCTGTTCTAAAATAGCACTAGGGTTGAGTTTGAGTGTTGGTGGATGTATTATTATTGTTTGTGGGTTAGTTTTGGTTTGGTTAATCTGGAGGCAGAAGTGTGGAGGAGAAAGTGATGTAGATCGTATGGTTGATTACTCCATGGACAAATTCGAGAAGGGTAAAGGCGCGAGAAAGTTTCCATTCAGCGATTTGGCTCAAGTGAAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04622 map04622

Pfam Domains

Protein Families

OTU

Protein Analysis

338

Amino Acids

37.21

Weight (kDa)

6.95

Isoelectric Point (pI)

34.12

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Lectin_legB	PF00139	35 - 122	3.5e-18	Legume lectin domain
Lectin_legB	PF00139	130 - 266	3.8e-14	Legume lectin domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003236)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G27350 AT2G27350 AT2G27350 AT2G27350 AT2G27350 AT2G27350
fragaria_vesca	FvH4_3g25610 FvH4_3g25610 FvH4_3g25610
malus_domestica	MD03G1149500.v1.1 MD11G1168400.v1.1
prunus_persica	Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1 Prupe.6G135500_v2.0.a1
pyrus_communis	pycom03g10340 pycom11g14110
rosa_chinensis	RchiOBHm_Chr5g0045751
rosa_laevigata	RLG00000034406
rosa_multiflora	Rmu_sc0005605.1_g000001
rosa_roxburghii	Rroxscaffold_1G00035070
rosa_rugosa	Rorug05G0227100 Rorug05G0227200 Rorug05G0227300 Rorug05G0227400
rosa_samantha	Rh5AG308100 Rh5BG316900 Rh5CG342900 Rh5DG327200
rosa_wichuraiana	Rw5G028860

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	480
AccB7I	CCANNNNNTGG	1 cut(s)	510
AccII	CGCG	2 cut(s)	347, 977
AciI	CCGC	1 cut(s)	347
AclWI	GGATC	6 cut(s)	443, 585, 593, 598, 687, 710
AcoI	YGGCCR	1 cut(s)	288
AcsI	RAATTY	3 cut(s)	661, 754, 956
AcyI	GRCGYC	1 cut(s)	477
AfaI	GTAC	2 cut(s)	31, 560
AfiI	CCNNNNNNNGG	3 cut(s)	346, 510, 515
AgsI	TTSAA	2 cut(s)	106, 765
AjnI	CCWGG	1 cut(s)	771
AluBI	AGCT	2 cut(s)	747, 791
AluI	AGCT	2 cut(s)	747, 791
Alw26I	GTCTC	1 cut(s)	153
AlwI	GGATC	6 cut(s)	443, 585, 593, 598, 687, 710
AoxI	GGCC	3 cut(s)	237, 288, 374
ApoI	RAATTY	3 cut(s)	661, 754, 956
AspLEI	GCGC	2 cut(s)	203, 977
AspS9I	GGNCC	3 cut(s)	237, 375, 615
AsuHPI	GGTGA	2 cut(s)	184, 289
AvaII	GGWCC	1 cut(s)	615
BaeI	ACNNNNGTAYC	2 cut(s)	211, 244
BamHI	GGATCC	1 cut(s)	590
BccI	CCATC	2 cut(s)	344, 627
BciT130I	CCWGG	1 cut(s)	773
BciVI	GTATCC	1 cut(s)	402
BcoDI	GTCTC	1 cut(s)	153
BfaI	CTAG	2 cut(s)	152, 827
BfmI	CTRYAG	2 cut(s)	244, 432
BfoI	RGCGCY	1 cut(s)	204
BfuI	GTATCC	1 cut(s)	402
BmcAI	AGTACT	1 cut(s)	560
Bme1390I	CCNGG	1 cut(s)	773
Bme18I	GGWCC	1 cut(s)	615
BmgT120I	GGNCC	3 cut(s)	237, 375, 615
BmiI	GGNNCC	4 cut(s)	592, 598, 617, 688
BmrFI	CCNGG	1 cut(s)	773
BpmI	CTGGAG	1 cut(s)	916
Bpu10I	CCTNAGC	2 cut(s)	40, 197
BpuEI	CTTGAG	2 cut(s)	473, 990
Bsa29I	ATCGAT	1 cut(s)	215
BsaBI	GATNNNNATC	1 cut(s)	927
BsaHI	GRCGYC	1 cut(s)	477
BsaJI	CCNNGG	3 cut(s)	371, 509, 948
BsaWI	WCCGGW	3 cut(s)	278, 423, 451
BsaXI	ACNNNNNCTCC	2 cut(s)	243, 273
Bsc4I	CCNNNNNNNGG	3 cut(s)	346, 510, 515
Bse1I	ACTGG	1 cut(s)	291
Bse8I	GATNNNNATC	1 cut(s)	927
BseBI	CCWGG	1 cut(s)	773
BseCI	ATCGAT	1 cut(s)	215
BseDI	CCNNGG	3 cut(s)	371, 509, 948
BseGI	GGATG	2 cut(s)	355, 857
BseJI	GATNNNNATC	1 cut(s)	927
BseLI	CCNNNNNNNGG	3 cut(s)	346, 510, 515
BseMII	CTCAG	1 cut(s)	378
BseNI	ACTGG	1 cut(s)	291
BseRI	GAGGAG	5 cut(s)	251, 589, 663, 699, 927
Bsh1236I	CGCG	2 cut(s)	347, 977
Bsh1285I	CGRYCG	1 cut(s)	235
BshFI	GGCC	3 cut(s)	239, 290, 376
BshVI	ATCGAT	1 cut(s)	215
BsiEI	CGRYCG	1 cut(s)	235
BsiSI	CCGG	5 cut(s)	279, 424, 452, 566, 594
BslFI	GGGAC	1 cut(s)	792
BslI	CCNNNNNNNGG	3 cut(s)	346, 510, 515
BsmAI	GTCTC	1 cut(s)	153
BsmBI	CGTCTC	1 cut(s)	153
BsmFI	GGGAC	1 cut(s)	792
BsnI	GGCC	3 cut(s)	239, 290, 376
Bsp19I	CCATGG	1 cut(s)	948
BspACI	CCGC	1 cut(s)	347
BspANI	GGCC	3 cut(s)	239, 290, 376
BspCNI	CTCAG	1 cut(s)	379
BspDI	ATCGAT	1 cut(s)	215
BspFNI	CGCG	2 cut(s)	347, 977
BspLI	GGNNCC	4 cut(s)	592, 598, 617, 688
BspMAI	CTGCAG	1 cut(s)	436
BspPI	GGATC	6 cut(s)	443, 585, 593, 598, 687, 710
BsrI	ACTGG	1 cut(s)	291
BssECI	CCNNGG	3 cut(s)	371, 509, 948
BssNI	GRCGYC	1 cut(s)	477
BssT1I	CCWWGG	3 cut(s)	371, 509, 948
Bst2UI	CCWGG	1 cut(s)	773
Bst4CI	ACNGT	2 cut(s)	248, 518
BstACI	GRCGYC	1 cut(s)	477
BstDEI	CTNAG	5 cut(s)	40, 197, 387, 620, 792
BstDSI	CCRYGG	1 cut(s)	948
BstF5I	GGATG	2 cut(s)	355, 857
BstFNI	CGCG	2 cut(s)	347, 977
BstH2I	RGCGCY	1 cut(s)	204
BstHHI	GCGC	2 cut(s)	203, 977
BstMAI	GTCTC	1 cut(s)	153
BstMCI	CGRYCG	1 cut(s)	235
BstNI	CCWGG	1 cut(s)	773
BstNSI	RCATGY	1 cut(s)	337
BstSCI	CCNGG	1 cut(s)	771
BstSFI	CTRYAG	2 cut(s)	244, 432
BstUI	CGCG	2 cut(s)	347, 977
BstX2I	RGATCY	3 cut(s)	590, 692, 702
BstYI	RGATCY	3 cut(s)	590, 692, 702
Bsu15I	ATCGAT	1 cut(s)	215
BsuI	GTATCC	1 cut(s)	402
BsuRI	GGCC	3 cut(s)	239, 290, 376
BsuTUI	ATCGAT	1 cut(s)	215
BtgI	CCRYGG	1 cut(s)	948
BtsCI	GGATG	2 cut(s)	355, 857
BtsI	GCAGTG	1 cut(s)	429
BtsIMutI	CAGTG	1 cut(s)	429
CfoI	GCGC	2 cut(s)	203, 977
Cfr13I	GGNCC	3 cut(s)	237, 375, 615
ClaI	ATCGAT	1 cut(s)	215
CseI	GACGC	2 cut(s)	170, 562
Csp6I	GTAC	2 cut(s)	30, 559
CviAII	CATG	4 cut(s)	334, 464, 750, 949
CviQI	GTAC	2 cut(s)	30, 559
DdeI	CTNAG	5 cut(s)	40, 197, 387, 620, 792
EaeI	YGGCCR	1 cut(s)	288
Eco130I	CCWWGG	3 cut(s)	371, 509, 948
Eco32I	GATATC	1 cut(s)	418
Eco47I	GGWCC	1 cut(s)	615
EcoO109I	RGGNCCY	1 cut(s)	615
EcoRII	CCWGG	1 cut(s)	771
EcoRV	GATATC	1 cut(s)	418
EcoT14I	CCWWGG	3 cut(s)	371, 509, 948
ErhI	CCWWGG	3 cut(s)	371, 509, 948
Esp3I	CGTCTC	1 cut(s)	153
FaeI	CATG	4 cut(s)	337, 467, 753, 952
FaiI	YATR	8 cut(s)	67, 335, 465, 648, 738, 751, 935, 950
FaqI	GGGAC	1 cut(s)	792
FatI	CATG	4 cut(s)	333, 463, 749, 948
FokI	GGATG	2 cut(s)	362, 864
FspBI	CTAG	2 cut(s)	152, 827
GlaI	GCGC	2 cut(s)	202, 976
GsuI	CTGGAG	1 cut(s)	916
HaeII	RGCGCY	1 cut(s)	204
HaeIII	GGCC	3 cut(s)	239, 290, 376
HapII	CCGG	5 cut(s)	279, 424, 452, 566, 594
HgaI	GACGC	2 cut(s)	170, 562
HhaI	GCGC	2 cut(s)	203, 977
Hin1I	GRCGYC	1 cut(s)	477
Hin1II	CATG	4 cut(s)	337, 467, 753, 952
Hin6I	GCGC	2 cut(s)	201, 975
HinP1I	GCGC	2 cut(s)	201, 975
HincII	GTYRAC	2 cut(s)	251, 481
HindII	GTYRAC	2 cut(s)	251, 481
HinfI	GANTC	2 cut(s)	212, 553
HpaII	CCGG	5 cut(s)	279, 424, 452, 566, 594
HphI	GGTGA	2 cut(s)	184, 289
Hpy166II	GTNNAC	2 cut(s)	251, 481
Hpy188I	TCNGA	3 cut(s)	585, 590, 612
Hpy188III	TCNNGA	2 cut(s)	895, 961
Hpy8I	GTNNAC	2 cut(s)	251, 481
HpyAV	CCTTC	6 cut(s)	167, 194, 265, 370, 524, 958
HpyCH4III	ACNGT	2 cut(s)	248, 518
HpyCH4IV	ACGT	3 cut(s)	222, 477, 657
HpyCH4V	TGCA	5 cut(s)	95, 434, 713, 731, 803
HpyF3I	CTNAG	5 cut(s)	40, 197, 387, 620, 792
HpySE526I	ACGT	3 cut(s)	222, 477, 657
Hsp92I	GRCGYC	1 cut(s)	477
Hsp92II	CATG	4 cut(s)	337, 467, 753, 952
HspAI	GCGC	2 cut(s)	201, 975
LmnI	GCTCC	2 cut(s)	602, 686
MaeI	CTAG	2 cut(s)	152, 827
MaeII	ACGT	3 cut(s)	222, 477, 657
MboII	GAAGA	1 cut(s)	359
MflI	RGATCY	3 cut(s)	590, 692, 702
MluCI	AATT	8 cut(s)	179, 322, 471, 651, 661, 726, 754, 956
MmeI	TCCRAC	1 cut(s)	448
MseI	TTAA	5 cut(s)	23, 83, 138, 638, 890
MspI	CCGG	5 cut(s)	279, 424, 452, 566, 594
MspR9I	CCNGG	1 cut(s)	773
MvaI	CCWGG	1 cut(s)	773
MvnI	CGCG	2 cut(s)	347, 977
NcoI	CCATGG	1 cut(s)	948
NlaIII	CATG	4 cut(s)	337, 467, 753, 952
NlaIV	GGNNCC	4 cut(s)	592, 598, 617, 688
NspI	RCATGY	1 cut(s)	337
PcsI	WCGNNNNNNNCGW	2 cut(s)	53, 168
PfeI	GAWTC	2 cut(s)	212, 553
PflMI	CCANNNNNTGG	1 cut(s)	510
PpuMI	RGGWCCY	1 cut(s)	615
Psp5II	RGGWCCY	1 cut(s)	615
Psp6I	CCWGG	1 cut(s)	771
PspGI	CCWGG	1 cut(s)	771
PspN4I	GGNNCC	4 cut(s)	592, 598, 617, 688
PspPI	GGNCC	3 cut(s)	237, 375, 615
PspPPI	RGGWCCY	1 cut(s)	615
PstI	CTGCAG	1 cut(s)	436
PsuI	RGATCY	3 cut(s)	590, 692, 702
RsaI	GTAC	2 cut(s)	31, 560
RsaNI	GTAC	2 cut(s)	30, 559
SaqAI	TTAA	5 cut(s)	23, 83, 138, 638, 890
Sau96I	GGNCC	3 cut(s)	237, 375, 615
ScaI	AGTACT	1 cut(s)	560
ScrFI	CCNGG	1 cut(s)	773
SetI	ASST	9 cut(s)	178, 225, 245, 480, 511, 660, 673, 749, 793
SfcI	CTRYAG	2 cut(s)	244, 432
SinI	GGWCC	1 cut(s)	615
SmlI	CTYRAG	2 cut(s)	488, 1005
SmoI	CTYRAG	2 cut(s)	488, 1005
Sse9I	AATT	8 cut(s)	179, 322, 471, 651, 661, 726, 754, 956
SsiI	CCGC	1 cut(s)	347
SspMI	CTAG	2 cut(s)	152, 827
StyD4I	CCNGG	1 cut(s)	771
StyI	CCWWGG	3 cut(s)	371, 509, 948
TaaI	ACNGT	2 cut(s)	248, 518
TaiI	ACGT	3 cut(s)	225, 480, 660
TaqI	TCGA	5 cut(s)	47, 171, 215, 363, 960
TaqII	GACCGA	1 cut(s)	221
TasI	AATT	8 cut(s)	179, 322, 471, 651, 661, 726, 754, 956
TatI	WGTACW	2 cut(s)	29, 558
TfiI	GAWTC	2 cut(s)	212, 553
Tru1I	TTAA	5 cut(s)	23, 83, 138, 638, 890
Tru9I	TTAA	5 cut(s)	23, 83, 138, 638, 890
TscAI	CASTG	1 cut(s)	436
TspDTI	ATGAA	4 cut(s)	225, 233, 663, 738
TspGWI	ACGGA	3 cut(s)	254, 384, 685
TspRI	CASTG	1 cut(s)	436
Van91I	CCANNNNNTGG	1 cut(s)	510
VpaK11BI	GGWCC	1 cut(s)	615
XapI	RAATTY	3 cut(s)	661, 754, 956
XceI	RCATGY	1 cut(s)	337
XcmI	CCANNNNNNNNNTGG	2 cut(s)	283, 347
XspI	CTAG	2 cut(s)	152, 827
ZraI	GACGTC	1 cut(s)	478
ZrmI	AGTACT	1 cut(s)	560

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.