Rorug05G0227300

OTU domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
23615339 .. 23615551
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0227300.1

Sequence Viewer

Length: 213 bp
ATGCCCAATGGTAGCCTAGATTTCCATCTCTTCAAAGCAAATATCTTGTTGATCTGGGAGGTAAGATATAAAATTGCTCTAGGCTTGGCATCGGGGTTGTTCTATCTACACGAAGGATGGGAACAATGTGTGCTCCATAGGGATATCAAATCCAGCAATGTTATGCTAGATTCCAATTTCAGTGCGAAGCTTGGAGATTTTGGATTGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.91

Weight (kDa)

6.23

Isoelectric Point (pI)

24.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 1 - 70 4e-10 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 2 - 70 7.7e-12 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 34
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
Alw21I GWGCWC 1 cut(s) 135
Bbv12I GWGCWC 1 cut(s) 135
BccI CCATC 2 cut(s) 33, 111
BfaI CTAG 3 cut(s) 17, 80, 167
BmsI GCATC 1 cut(s) 98
BsaBI GATNNNNATC 1 cut(s) 24
Bse3DI GCAATG 1 cut(s) 163
Bse8I GATNNNNATC 1 cut(s) 24
BseGI GGATG 1 cut(s) 122
BseJI GATNNNNATC 1 cut(s) 24
BseMI GCAATG 1 cut(s) 163
BsiHKAI GWGCWC 1 cut(s) 135
Bsp1286I GDGCHC 1 cut(s) 135
Bsp143I GATC 1 cut(s) 51
BsrDI GCAATG 1 cut(s) 163
BssMI GATC 1 cut(s) 51
Bst6I CTCTTC 1 cut(s) 35
BstF5I GGATG 1 cut(s) 122
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BtsCI GGATG 1 cut(s) 122
BtsIMutI CAGTG 1 cut(s) 187
CviJI RGCY 4 cut(s) 15, 84, 190, 209
CviKI_1 RGCY 4 cut(s) 15, 84, 190, 209
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Eam1104I CTCTTC 1 cut(s) 35
EarI CTCTTC 1 cut(s) 35
Eco32I GATATC 1 cut(s) 145
EcoRV GATATC 1 cut(s) 145
FaiI YATR 3 cut(s) 69, 138, 164
FokI GGATG 1 cut(s) 129
FspBI CTAG 3 cut(s) 17, 80, 167
HindIII AAGCTT 1 cut(s) 188
HinfI GANTC 1 cut(s) 170
HpyAV CCTTC 1 cut(s) 107
Kzo9I GATC 1 cut(s) 51
LmnI GCTCC 1 cut(s) 138
LpnPI CCDG 2 cut(s) 40, 166
LweI GCATC 1 cut(s) 98
MaeI CTAG 3 cut(s) 17, 80, 167
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 1 cut(s) 22
MhlI GDGCHC 1 cut(s) 135
MluCI AATT 2 cut(s) 72, 175
MnlI CCTC 1 cut(s) 52
NdeII GATC 1 cut(s) 51
PfeI GAWTC 1 cut(s) 170
Sau3AI GATC 1 cut(s) 51
SduI GDGCHC 1 cut(s) 135
SetI ASST 2 cut(s) 63, 192
SfaNI GCATC 1 cut(s) 98
Sse9I AATT 2 cut(s) 72, 175
SspMI CTAG 3 cut(s) 17, 80, 167
TasI AATT 2 cut(s) 72, 175
TfiI GAWTC 1 cut(s) 170
TscAI CASTG 1 cut(s) 187
TspRI CASTG 1 cut(s) 187
XspI CTAG 3 cut(s) 17, 80, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.