Rorug05G0290400

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
33366886 .. 33368734
1849 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0290400.1

Sequence Viewer

Length: 222 bp
ATGGCATTAATTTGGTCGAAGATGAGTACAGGGCTTCCTATAGATATCTCTTCATCAATGAAGGGCCAAAGTTATAATTCTTTCTGCAGACTGGATATAGATATTCATCGGAACATTCCTCATGTTCATATACATGAAAAACGGGAAAACAAGGATAGGTGGCATGGTGCTGAAATCCAAGTTGTTATTGAGGGGAATTGGACAACTTACCGTGTAAAGTGA

Protein Analysis

73

Amino Acids

8.58

Weight (kDa)

8.93

Isoelectric Point (pI)

65.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 75
AfaI GTAC 1 cut(s) 28
AoxI GGCC 1 cut(s) 64
AseI ATTAAT 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 64
BfmI CTRYAG 2 cut(s) 39, 85
BmgT120I GGNCC 1 cut(s) 64
BsaBI GATNNNNATC 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 96
Bse8I GATNNNNATC 1 cut(s) 105
BseJI GATNNNNATC 1 cut(s) 105
BseNI ACTGG 1 cut(s) 96
BshFI GGCC 1 cut(s) 66
BsnI GGCC 1 cut(s) 66
BspANI GGCC 1 cut(s) 66
BspMAI CTGCAG 1 cut(s) 89
BsrI ACTGG 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 212
Bst6I CTCTTC 1 cut(s) 55
BstSFI CTRYAG 2 cut(s) 39, 85
BsuRI GGCC 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 64
Csp6I GTAC 1 cut(s) 27
CviAII CATG 3 cut(s) 122, 134, 164
CviJI RGCY 2 cut(s) 34, 66
CviKI_1 RGCY 2 cut(s) 34, 66
CviQI GTAC 1 cut(s) 27
Eam1104I CTCTTC 1 cut(s) 55
EarI CTCTTC 1 cut(s) 55
Eco32I GATATC 1 cut(s) 46
EcoRV GATATC 1 cut(s) 46
FaeI CATG 3 cut(s) 125, 137, 167
FaiI YATR 8 cut(s) 41, 75, 98, 123, 129, 131, 135, 165
FatI CATG 3 cut(s) 121, 133, 163
HaeIII GGCC 1 cut(s) 66
Hin1II CATG 3 cut(s) 125, 137, 167
Hpy188I TCNGA 1 cut(s) 111
HpyAV CCTTC 1 cut(s) 55
HpyCH4III ACNGT 1 cut(s) 212
HpyCH4V TGCA 1 cut(s) 87
Hsp92II CATG 3 cut(s) 125, 137, 167
LpnPI CCDG 2 cut(s) 15, 77
MboII GAAGA 2 cut(s) 31, 42
MluCI AATT 3 cut(s) 9, 76, 196
MnlI CCTC 2 cut(s) 129, 184
MseI TTAA 1 cut(s) 8
MslI CAYNNNNRTG 1 cut(s) 132
NlaIII CATG 3 cut(s) 125, 137, 167
PshBI ATTAAT 1 cut(s) 8
PsiI TTATAA 1 cut(s) 75
PspPI GGNCC 1 cut(s) 64
PstI CTGCAG 1 cut(s) 89
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
RseI CAYNNNNRTG 1 cut(s) 132
SaqAI TTAA 1 cut(s) 8
Sau96I GGNCC 1 cut(s) 64
SetI ASST 1 cut(s) 161
SfcI CTRYAG 2 cut(s) 39, 85
SgeI CNNG 8 cut(s) 42, 104, 134, 146, 155, 163, 176, 191
SmiMI CAYNNNNRTG 1 cut(s) 132
Sse9I AATT 3 cut(s) 9, 76, 196
TaaI ACNGT 1 cut(s) 212
TaqI TCGA 1 cut(s) 17
TasI AATT 3 cut(s) 9, 76, 196
TatI WGTACW 1 cut(s) 26
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TspDTI ATGAA 5 cut(s) 42, 74, 95, 116, 150
VspI ATTAAT 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.