Rorug05G0334800

Involved in biosynthesis of the thiamine precursor thiazole. Catalyzes the conversion of NAD and glycine to adenosine diphosphate 5-(2-hydroxyethyl)-4-methylthiazole-2-carboxylic acid (ADT), an adenylated thiazole intermediate. The reaction includes an iron-dependent sulfide transfer from a conserved cysteine residue of the protein to a thiazole intermediate. The enzyme can only undergo a single turnover, which suggests it is a suicide enzyme. May have additional roles in adaptation to various stress conditions and in DNA damage tolerance

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
40564515 .. 40565206
692 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0334800.1

Sequence Viewer

Length: 330 bp
ATGGCTATACGTGTTGGTGCACTAATCTCAAACAATAAATACAGAAGCGGAATTCATAGAGTACTTGCCAAGAAGGAAGGTCCAAGAGTTTCGGTGGGTTGTTTTTTCAGGCATGTTCCACTAGAAAATTCTGCAGGGAGGCTCTATGAGCCGATCAAGGAGTTGACATCAGAAGAAAATCCCCCAATATACGTTGGAACAACTGTGACAGATTACATGCGGGGCCACTACATTAAAGGGTTGATCGATGGGGATCAATTCTATGTTGCTGTTTTGCCAAGGATACAGGAAAAGATCGATCGTTATGAGACAAAAAGCTTTTCAACTTGA

Protein Analysis

109

Amino Acids

12.41

Weight (kDa)

9.3

Isoelectric Point (pI)

28.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 48, 220
AclWI GGATC 1 cut(s) 261
AcsI RAATTY 2 cut(s) 51, 127
AfaI GTAC 1 cut(s) 63
AflIII ACRYGT 1 cut(s) 10
AgsI TTSAA 1 cut(s) 324
AluBI AGCT 1 cut(s) 318
AluI AGCT 1 cut(s) 318
Alw21I GWGCWC 1 cut(s) 22
Alw26I GTCTC 1 cut(s) 302
Alw44I GTGCAC 1 cut(s) 18
AlwI GGATC 1 cut(s) 261
AoxI GGCC 1 cut(s) 223
ApaLI GTGCAC 1 cut(s) 18
ApoI RAATTY 2 cut(s) 51, 127
AspS9I GGNCC 2 cut(s) 80, 223
AvaII GGWCC 1 cut(s) 80
BaeGI GKGCMC 1 cut(s) 22
Bbv12I GWGCWC 1 cut(s) 22
BccI CCATC 1 cut(s) 242
BciVI GTATCC 1 cut(s) 276
BcoDI GTCTC 1 cut(s) 302
BfaI CTAG 1 cut(s) 122
BfmI CTRYAG 1 cut(s) 132
BfuI GTATCC 1 cut(s) 276
BmcAI AGTACT 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 80
BmgT120I GGNCC 2 cut(s) 80, 223
BmiI GGNNCC 1 cut(s) 224
Bsa29I ATCGAT 2 cut(s) 246, 297
BsaAI YACGTR 1 cut(s) 11
BsaBI GATNNNNATC 1 cut(s) 252
BsaJI CCNNGG 1 cut(s) 278
Bse8I GATNNNNATC 1 cut(s) 252
BseCI ATCGAT 2 cut(s) 246, 297
BseDI CCNNGG 1 cut(s) 278
BseJI GATNNNNATC 1 cut(s) 252
BseSI GKGCMC 1 cut(s) 22
Bsh1285I CGRYCG 1 cut(s) 301
BshFI GGCC 1 cut(s) 225
BshVI ATCGAT 2 cut(s) 246, 297
BsiEI CGRYCG 1 cut(s) 301
BsiHKAI GWGCWC 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 302
BsnI GGCC 1 cut(s) 225
Bsp1286I GDGCHC 1 cut(s) 22
Bsp143I GATC 5 cut(s) 153, 243, 253, 294, 298
BspACI CCGC 2 cut(s) 48, 220
BspANI GGCC 1 cut(s) 225
BspDI ATCGAT 2 cut(s) 246, 297
BspLI GGNNCC 1 cut(s) 224
BspMAI CTGCAG 1 cut(s) 136
BspPI GGATC 1 cut(s) 261
BssECI CCNNGG 1 cut(s) 278
BssMI GATC 5 cut(s) 153, 243, 253, 294, 298
BssT1I CCWWGG 1 cut(s) 278
Bst4CI ACNGT 1 cut(s) 205
BstBAI YACGTR 1 cut(s) 11
BstKTI GATC 5 cut(s) 156, 246, 256, 297, 301
BstMAI GTCTC 1 cut(s) 302
BstMBI GATC 5 cut(s) 153, 243, 253, 294, 298
BstMCI CGRYCG 1 cut(s) 301
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstNSI RCATGY 2 cut(s) 116, 220
BstSFI CTRYAG 1 cut(s) 132
BstSLI GKGCMC 1 cut(s) 22
Bsu15I ATCGAT 2 cut(s) 246, 297
BsuI GTATCC 1 cut(s) 276
BsuRI GGCC 1 cut(s) 225
BsuTUI ATCGAT 2 cut(s) 246, 297
Cfr13I GGNCC 2 cut(s) 80, 223
ClaI ATCGAT 2 cut(s) 246, 297
Csp6I GTAC 1 cut(s) 62
CviAII CATG 2 cut(s) 113, 217
CviJI RGCY 5 cut(s) 5, 142, 151, 225, 318
CviKI_1 RGCY 5 cut(s) 5, 142, 151, 225, 318
CviQI GTAC 1 cut(s) 62
DpnI GATC 5 cut(s) 155, 245, 255, 296, 300
DpnII GATC 5 cut(s) 153, 243, 253, 294, 298
Eco130I CCWWGG 1 cut(s) 278
Eco47I GGWCC 1 cut(s) 80
EcoRI GAATTC 1 cut(s) 51
EcoT14I CCWWGG 1 cut(s) 278
ErhI CCWWGG 1 cut(s) 278
FaeI CATG 2 cut(s) 116, 220
FaiI YATR 8 cut(s) 8, 57, 114, 147, 190, 218, 264, 306
FatI CATG 2 cut(s) 112, 216
FauI CCCGC 1 cut(s) 213
FspBI CTAG 1 cut(s) 122
HaeIII GGCC 1 cut(s) 225
Hin1II CATG 2 cut(s) 116, 220
HincII GTYRAC 1 cut(s) 165
HindII GTYRAC 1 cut(s) 165
HindIII AAGCTT 1 cut(s) 316
Hpy166II GTNNAC 2 cut(s) 20, 165
Hpy188I TCNGA 1 cut(s) 172
Hpy8I GTNNAC 2 cut(s) 20, 165
HpyAV CCTTC 2 cut(s) 67, 71
HpyCH4III ACNGT 1 cut(s) 205
HpyCH4IV ACGT 2 cut(s) 10, 192
HpyCH4V TGCA 2 cut(s) 20, 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
HpySE526I ACGT 2 cut(s) 10, 192
Hsp92II CATG 2 cut(s) 116, 220
Kzo9I GATC 5 cut(s) 153, 243, 253, 294, 298
LpnPI CCDG 3 cut(s) 94, 120, 272
MaeI CTAG 1 cut(s) 122
MaeII ACGT 2 cut(s) 10, 192
MaeIII GTNAC 1 cut(s) 205
MalI GATC 5 cut(s) 155, 245, 255, 296, 300
MboI GATC 5 cut(s) 153, 243, 253, 294, 298
MboII GAAGA 1 cut(s) 185
MhlI GDGCHC 1 cut(s) 22
MluCI AATT 3 cut(s) 51, 127, 257
MmeI TCCRAC 1 cut(s) 175
MnlI CCTC 1 cut(s) 132
MseI TTAA 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 5 cut(s) 153, 243, 253, 294, 298
NlaIII CATG 2 cut(s) 116, 220
NlaIV GGNNCC 1 cut(s) 224
NmuCI GTSAC 1 cut(s) 205
NspI RCATGY 2 cut(s) 116, 220
Ple19I CGATCG 1 cut(s) 301
Ppu21I YACGTR 1 cut(s) 11
PspN4I GGNNCC 1 cut(s) 224
PspPI GGNCC 2 cut(s) 80, 223
PstI CTGCAG 1 cut(s) 136
PvuI CGATCG 1 cut(s) 301
RsaI GTAC 1 cut(s) 63
RsaNI GTAC 1 cut(s) 62
SaqAI TTAA 1 cut(s) 234
Sau3AI GATC 5 cut(s) 153, 243, 253, 294, 298
Sau96I GGNCC 2 cut(s) 80, 223
ScaI AGTACT 1 cut(s) 63
SduI GDGCHC 1 cut(s) 22
SetI ASST 4 cut(s) 13, 82, 195, 320
SfcI CTRYAG 1 cut(s) 132
SinI GGWCC 1 cut(s) 80
Sse9I AATT 3 cut(s) 51, 127, 257
SsiI CCGC 2 cut(s) 48, 220
SspMI CTAG 1 cut(s) 122
StyI CCWWGG 1 cut(s) 278
TaaI ACNGT 1 cut(s) 205
TaiI ACGT 2 cut(s) 13, 195
TaqI TCGA 2 cut(s) 246, 297
TasI AATT 3 cut(s) 51, 127, 257
TatI WGTACW 1 cut(s) 61
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TseFI GTSAC 1 cut(s) 205
Tsp45I GTSAC 1 cut(s) 205
TspDTI ATGAA 1 cut(s) 44
VneI GTGCAC 1 cut(s) 18
VpaK11BI GGWCC 1 cut(s) 80
XapI RAATTY 2 cut(s) 51, 127
XceI RCATGY 2 cut(s) 116, 220
XspI CTAG 1 cut(s) 122
ZrmI AGTACT 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.