Rorug05G0423100

Belongs to the DEAD box helicase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0011549
Physical Location & Seq
Reverse (-)
58802976 .. 58803962
987 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0423100.1

Sequence Viewer

Length: 375 bp
ATGGCCTTCGTCCCAGACAGAGGGAGTTCTTCATTGGCTTCACAAAGGGCCAGTTGCAGCTCTGCTGATCTCCAAAAGCCAGCTGAACTGGATGGGAAGGCATGTGCAGCTGTTGGACAGCCTGATCTGATGGCTCTCTTTAAGTCCGTGTTTAGTGAGCTAAAAGAAACGGTCGATCACTTGCTGTCTTTAAAGACTATACCTATATTCAATGAAAATGATGCAGTTAGTACCAGAACAGATTTATGTGAGGATTCTTCTGGTATATTTTGGGACAATGACAGTTTGGCAGCTATACTAGCTAAGGAGCTAAAGGCTGATCTTCTTATCCTTATGAGTGATGTGGAGGGTCTCTACAGTGGGCCTCCCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 ko05202 ko05205 map03040 map05202 map05205
Pfam Domains
Protein Families
DEAD Helicase_C

Protein Analysis

124

Amino Acids

13.25

Weight (kDa)

4.45

Isoelectric Point (pI)

36.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AA_kinase PF00696 50 - 124 2.8e-13 Amino acid kinase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 1 cut(s) 211
AluBI AGCT 7 cut(s) 60, 83, 110, 160, 293, 302, 310
AluI AGCT 7 cut(s) 60, 83, 110, 160, 293, 302, 310
Alw26I GTCTC 1 cut(s) 356
AoxI GGCC 3 cut(s) 3, 48, 362
ApeKI GCWGC 3 cut(s) 57, 107, 290
AspS9I GGNCC 2 cut(s) 48, 362
BbvI GCAGC 3 cut(s) 69, 119, 302
BccI CCATC 2 cut(s) 86, 124
BcoDI GTCTC 1 cut(s) 356
BfaI CTAG 1 cut(s) 299
BfmI CTRYAG 1 cut(s) 355
BisI GCNGC 3 cut(s) 58, 108, 291
BlsI GCNGC 3 cut(s) 59, 109, 292
BmgT120I GGNCC 2 cut(s) 48, 362
BmsI GCATC 1 cut(s) 211
Bpu10I CCTNAGC 1 cut(s) 303
BsaI GGTCTC 1 cut(s) 356
Bsc4I CCNNNNNNNGG 1 cut(s) 20
Bse1I ACTGG 2 cut(s) 51, 93
BseGI GGATG 1 cut(s) 97
BseLI CCNNNNNNNGG 1 cut(s) 20
BseNI ACTGG 2 cut(s) 51, 93
BseXI GCAGC 3 cut(s) 69, 119, 302
BsgI GTGCAG 1 cut(s) 126
Bsh1285I CGRYCG 1 cut(s) 174
BshFI GGCC 3 cut(s) 5, 50, 364
BsiEI CGRYCG 1 cut(s) 174
BslFI GGGAC 1 cut(s) 287
BslI CCNNNNNNNGG 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 356
BsmFI GGGAC 1 cut(s) 287
BsnI GGCC 3 cut(s) 5, 50, 364
Bso31I GGTCTC 1 cut(s) 356
Bsp143I GATC 4 cut(s) 67, 124, 175, 319
BspANI GGCC 3 cut(s) 5, 50, 364
BspTNI GGTCTC 1 cut(s) 356
BsrI ACTGG 2 cut(s) 51, 93
BssMI GATC 4 cut(s) 67, 124, 175, 319
Bst4CI ACNGT 3 cut(s) 172, 284, 359
BstC8I GCNNGC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 303
BstF5I GGATG 1 cut(s) 97
BstKTI GATC 4 cut(s) 70, 127, 178, 322
BstMAI GTCTC 1 cut(s) 356
BstMBI GATC 4 cut(s) 67, 124, 175, 319
BstMCI CGRYCG 1 cut(s) 174
BstMWI GCNNNNNNNGC 2 cut(s) 107, 299
BstNSI RCATGY 1 cut(s) 105
BstSFI CTRYAG 1 cut(s) 355
BstV1I GCAGC 3 cut(s) 69, 119, 302
BsuRI GGCC 3 cut(s) 5, 50, 364
BtsCI GGATG 1 cut(s) 97
BtsIMutI CAGTG 1 cut(s) 364
Cac8I GCNNGC 1 cut(s) 81
Cfr13I GGNCC 2 cut(s) 48, 362
Csp6I GTAC 1 cut(s) 231
CviAII CATG 1 cut(s) 102
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 1 cut(s) 303
DpnI GATC 4 cut(s) 69, 126, 177, 321
DpnII GATC 4 cut(s) 67, 124, 175, 319
DraI TTTAAA 1 cut(s) 192
Eco31I GGTCTC 1 cut(s) 356
FaeI CATG 1 cut(s) 105
FaiI YATR 7 cut(s) 103, 200, 206, 247, 266, 296, 335
FaqI GGGAC 1 cut(s) 287
FatI CATG 1 cut(s) 101
Fnu4HI GCNGC 3 cut(s) 58, 108, 291
FokI GGATG 1 cut(s) 104
Fsp4HI GCNGC 3 cut(s) 58, 108, 291
FspBI CTAG 1 cut(s) 299
GluI GCNGC 3 cut(s) 58, 108, 291
HaeIII GGCC 3 cut(s) 5, 50, 364
Hin1II CATG 1 cut(s) 105
HinfI GANTC 1 cut(s) 254
Hpy188I TCNGA 1 cut(s) 129
HpyAV CCTTC 2 cut(s) 16, 91
HpyCH4III ACNGT 3 cut(s) 172, 284, 359
HpyCH4V TGCA 3 cut(s) 57, 107, 224
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 299
HpyF3I CTNAG 1 cut(s) 303
Hsp92II CATG 1 cut(s) 105
Kzo9I GATC 4 cut(s) 67, 124, 175, 319
LmnI GCTCC 1 cut(s) 307
LpnPI CCDG 7 cut(s) 27, 64, 74, 93, 135, 246, 247
Lsp1109I GCAGC 3 cut(s) 69, 119, 302
LweI GCATC 1 cut(s) 211
MaeI CTAG 1 cut(s) 299
MalI GATC 4 cut(s) 69, 126, 177, 321
MboI GATC 4 cut(s) 67, 124, 175, 319
MboII GAAGA 3 cut(s) 21, 249, 314
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 4 cut(s) 14, 244, 340, 375
MseI TTAA 2 cut(s) 141, 191
MspA1I CMGCKG 2 cut(s) 83, 110
MwoI GCNNNNNNNGC 2 cut(s) 107, 299
NdeII GATC 4 cut(s) 67, 124, 175, 319
NlaIII CATG 1 cut(s) 105
NspI RCATGY 1 cut(s) 105
PfeI GAWTC 1 cut(s) 254
PkrI GCNGC 3 cut(s) 59, 109, 292
PspPI GGNCC 2 cut(s) 48, 362
PvuII CAGCTG 2 cut(s) 83, 110
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
SaqAI TTAA 2 cut(s) 141, 191
SatI GCNGC 3 cut(s) 58, 108, 291
Sau3AI GATC 4 cut(s) 67, 124, 175, 319
Sau96I GGNCC 2 cut(s) 48, 362
SetI ASST 8 cut(s) 62, 85, 112, 162, 205, 295, 304, 312
SfaNI GCATC 1 cut(s) 211
SfcI CTRYAG 1 cut(s) 355
SspMI CTAG 1 cut(s) 299
TaaI ACNGT 3 cut(s) 172, 284, 359
TaqI TCGA 1 cut(s) 174
TfiI GAWTC 1 cut(s) 254
Tru1I TTAA 2 cut(s) 141, 191
Tru9I TTAA 2 cut(s) 141, 191
TscAI CASTG 1 cut(s) 364
TseI GCWGC 3 cut(s) 57, 107, 290
TspDTI ATGAA 2 cut(s) 21, 228
TspGWI ACGGA 1 cut(s) 136
TspRI CASTG 1 cut(s) 364
XceI RCATGY 1 cut(s) 105
XspI CTAG 1 cut(s) 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.